cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.65 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.5 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

The library was prepared from total RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1811 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 0.5-1.5 kb size fraction (additional size fractions contained in the NIH_XGC_tropBrn3 and Brn4 libraries). Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 1.5-2 kb size fraction (additional size fractions contained in the NIH_XGC_tropBrn2 and Brn4 libraries). Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 2-3 kb size fraction (additional size fractions contained in the NIH_XGC_tropBrn2 and Brn3 libraries). Library constructed at the DOE Joint Genome Institute.

cDNA oligo-dT primed using oligo 5'-GAGAGAGAGAGGATCCAATACTGGAGAGTTTTTTTTTTTTTTTTVN-3' and directionally cloned into XhoI and BamHI sites using the 5' adaptor 5'- AGAGAGAGAGCTCGAGCTCTAATAAGGTGACACTATAGAACCA-3'. Size selection was done automatically by the cloning vector (lambda FLC-II, P. Carninci et al., unpublished). Library was amplified at the phage stage and normalized (RoT value = 5). This library was constructed using the CapTrapper method and Trehalose thermoactivated reverse transcriptase to enrich for full-length clones. Library constructed by Piero Carninci (RIKEN, Genome Science Laboratory, Japan: http://genome.rtc.riken.go.jp/) using egg RNA supplied by Marc Kirschner (Harvard Medical School, Dept. of Cell Biology). References: Methods Enzymol.303:19-44 and Genome Res. 10:1617-1630 Please contact Marc Kirschner (marc@hms.harvard.edu) for information on obtaining aliquots of this cDNA library.

1st strand was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGAATCTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

cDNAs were oligo-dT primed and directionally cloned. Average insert size 1.5 kb, range 0.5-4 kb. Library constructed by A. Zorn and J. Mason (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

cDNA from 2 ug polyA+ mRNA, oligo dT-primed using 5'-ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTT-3'. 500,000 unamplified cDNAs were mass excised (from lambda-ZAPII) using ExAssist phage. The resulting single-stranded phagemids were used to infect TOP10F'. This library has been used successfully to clone a number of full-length cDNAs ranging in size from 1.4-4.5 kb. There are <0.5% clones with multiple inserts. One should be suspicious of any clone which gives 3 or more bands in an EcoRI/XhoI digest AND has an internal XhoI site. Library constructed and donated by B. Blumberg (University of California, Irvine), also referred to as Xenopus_laevis_unfertilized_egg_cDNA_library.

Library was prepared from 50 ug of total RNA by oligo-dT priming and AMV reverse transcriptase. After addition of EcoRI linkers and EcoRI-XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-4B columns and fractions containing cDNAs larger than 500 bp were ligated into EcoRI-XhoI-digested lambda ZAPII (UniZAP-XR) and packaged in vitro. Average insert size is 1.4 kb. The original library contained 6 x 106 recombinants, of which 3 x 106 were amplified and stored at 70C in SM buffer containing 7% DMSO. 3 x 106 pfu were mass excised and the resulting phagemids used to infect Top10F'. References: Science 253, 196-196 and Methods in Molecular Biology 97, 555-574. Additional sequences from this library have been deposited under the name Xenopus laevis dorsal blastopore lip. Library constructed by Bruce Blumberg (University of California, Irvine, Department of Developmental and Cell Biology).

1st strand was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and Eco RI sites of pBluescript KS+. Library was constructed by C. Hashimoto, Ph.D., in the laboratory of K. Cho, Ph.D. (Department of Developmental and Cell Biology, University of California, Irvine).

cDNA made by oligo-dT priming. Library constructed in the laboratory of R. Harland, Ph.D. (University of California, Berkeley).

Size-selected for average insert size 1.2 kb. Library was constructed and donated by M. Kirschner (Harvard Medical School).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.55 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 1.8kb. This is a normalized library (primary library is NICHD_XGC_Emb9) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by Life Technologies. NOTE: based on EST sequencing of several thousand clones from this library, there appears to be a low level of mouse background in this library; please use care when evaluating sequences from this library. Note: this is a Xenopus Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.7 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.0 kb. Constructed by Invitrogen. Note: this is a Xenopus Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by Invitrogen. Note: this is a Xenopus Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by Invitrogen. Note: this is a Xenopus Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by Invitrogen. Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 2.1kb. This is a non-normalized primary library (normalized library is NICHD_XGC_Emb10) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.8 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'-GAGAGAGAGAGAGCTCT(20)V-3'). After ligation of PstI adapters and XhoI and PstI digestion, the cDNA was size selected by chromatography on Sepharose CL-4B columns and fractions containing cDNAs larger than 500 bp were ligated into PstI/XhoI-digested pCS22+. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Jisong Peng and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'-GAGAGAGAGAGAGCTCT(20)V-3'). After ligation of PstI adapters and XhoI and PstI digestion, the cDNA was size selected by chromatography on Sepharose CL-4B columns and fractions containing cDNAs larger than 500 bp were ligated into PstI/XhoI-digested pCS22+. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Jisong Peng and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

Library constructed using poly A RNA and oligo dT primers (Invitrogen SuperScript Plasmid System for cDNA Synthesis and Cloning). After second-strand synthesis, cDNA was size-fractionated on a sepharose 4B-CL 30 cm column and directionally cloned into pCS108 (http://mcb.berkeley.edu/labs/harland/pages/plasmids.html). Library constructed by Russell B. Fletcher in R. Harland's laboratory (University of California, Berkeley, Dept of Molecular and Cell Biology).

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis (0.5-1.5 kb fraction; NIH_XGC_tropMet9 contains the 1.5-2.5 kb fraction) and ligated into SalI and NotI digested pCMV-SPORT6 vector. Primary library, not amplified. Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pSPORT1 vector. This library contains the 1.5-2 kb size fraction (the 0.5-1.5 kb fraction is contained in the NIH_XGC_tropMet3 library). Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pSPORT1 vector. This library contains the 0.5-1.5 kb size fraction (the 1.5-2 kb fraction is contained in the NIH_XGC_tropMet2 library).Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pSPORT1 vector. Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis (1.5-2.5 kb fraction; NIH_XGC_tropMet8 contains the 0.5-1.5 kb fraction) and ligated into SalI and NotI digested pCMV-SPORT6 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis (0.5-1.5 kb fraction; NIH_XGC_tropMet7 contains the 1.5-2.5 kb fraction) and ligated into SalI and NotI digested pCMV-SPORT6 vector. Primary library, not amplified. Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis (1.5-2.5 kb fraction; NIH_XGC_tropMet10 contains the 0.5-1.5 kb fraction) and ligated into SalI and NotI digested pCMV-SPORT6 vector. Primary library, not amplified. Library constructed at the DOE Joint Genome Institute.

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'-GAGAGAGAGAGAGCTCT(20)V-3'). After ligation of PstI adapters and XhoI and PstI digestion, the cDNA was size selected by chromatography on Sepharose CL-4B columns and fractions containing cDNAs larger than 500 bp were ligated into PstI/XhoI-digested pCS22+. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Jisong Peng and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

Library constructed using poly A RNA and oligo dT primers (Invitrogen SuperScript Plasmid System for cDNA Synthesis and Cloning). After second-strand synthesis, cDNA was size-fractionated on a sepharose 4B-CL 30 cm column and directionally cloned into pCS108 (http://mcb.berkeley.edu/labs/harland/pages/plasmids.html). Library constructed by Russell B. Fletcher in R. Harland's laboratory (University of California, Berkeley, Dept of Molecular and Cell Biology).

cDNAs were oligo-dT primed and directionally cloned. Average insert size 1.5 kb, range 0.5-4 kb. Library constructed by A. Zorn and J. Mason (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett and A.M. Zorn, (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, E. Bellefroid, and A.M. Zorn, (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library is subtracted and was constructed by N. Garrett, E Bellefroid, and A.M. Zorn, (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, E. Bellefroid, and A.M. Zorn, (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library is subtracted and was constructed by N. Garrett and A.M. Zorn, (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by A.M. Zorn (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, K. Ryan and A.M. Zorn, (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute). There have been no sequences generated or submitted to Genbank from this library.

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

cDNA from 2 ug polyA+ mRNA, oligo dT-primed using 5'-ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTT-3'. Library was mass excised (from lambda-ZAPII) using ExAssist phage. The resulting single-stranded phagemids were used to infect TOP10F'. This library has been used successfully to clone a number of full-length cDNAs ranging in size from 1.4-4.5 kb. There are <0.5% clones with multiple inserts. One should be suspicious of any clone which gives 3 or more bands in an EcoRI/XhoI digest AND has an internal XhoI site. Library constructed and donated by B. Blumberg (University of California, Irvine); also referred to as Xenopus_laevis_gastrula_non_normalized.

cDNA made by oligo-dT priming. Directionally cloned into SalI/NotI sites using the following 5' adaptor: tcgacccacgcgtccg and 3' adaptor: gactagttctagatcgcgagcggccgcccttttttttttttttt. Average insert size 1.3kb. Primary library, non-amplified. Library constructed by V. Gawantka, PhD. REF: Gawantka, V., Pollet, N., Delius, H., Vingron, M., Pfister, R., Nitsch, R., Blumenstock, C., and Niehrs, C. (1998) Gene expression screening in Xenopus identifies molecular pathways, predicts gene function and provides a global view of embryonic patterning. Mech. Dev. 77:95-141.

cDNA made by oligo-dT priming. Directionally cloned into EcoRI/NotI sites using the following 5' adaptor: gaattccccggg and 3' adaptor: agagaactagtgtcgacgcggccgcttttttttttttttttttt. Vector designed for mRNA injections (reference Lemaire et al. (1995) 81:85-94). Average insert size 1.6kb. Primary library, non-amplified. Library constructed by A. Glinka, PhD. REF: Glinka, et al. (1996) Combinatorial signaling by Xwnt-11 and Xnr3 in the organizer epithelium. Mech. Dev. 60:221-231.

10 ug of polyA+ RNA was isolated from a mixture of embryos at stage 10, 20 and 30 and primed by oligo-dT primer: 5'-GAGAGAGAGAAGGATCC(T)16VN-3' (where V=G,A,C). 5-methyl-dCTP was used instead of dCTP in the first-strand synthesis in order to get hemimethylated cDNA. After full-length enrichment, oligo-dG tailing and normalization against itself, second-strand synthesis was carried out by priming with 5'-GAGAGAGAGACTCGAGTTAATTAAT(C)13-3'. dsDNA was digested with XhoI/BamHI and directionally cloned into the pRKW2 vector. Average insert size is 1.5 kb. Library constructed using the Carninci protocol (Genome Research 2000) by Drs. W. Wu and C. Niehrs (DKFZ, Heidelberg, Germany).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.3 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.2kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.2kb resulted in an average insert size of 1.8kb. This is a primary library (normalized library is NICHD_XGC_FaBN) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.2kb resulted in an average insert size of 1.5kb, and Cot value of 7. This is a normalized library (primary library is NICHD_XGC_FaB) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1905 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Center (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Center (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1678 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

Library prepared from 5 ug of poly A+ RNA by oligo-dT priming [5'-GA(10)CTAGTCTCGAGT(18)-3'] and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and XhoI digestion, the cDNA was size-selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1 kb were ligated into EcoRI/XhoI digested pCS107 vector. Average insert size is 2.1 kb. The original library contained 9E4 recombinants. Reference: Current Genomics 4, 635-644. Use sp6 to obtain 5' end sequence, and t7 or t3 to obtain 3' end sequence. Library constructed by Bruce Blumberg (University of California, Irvine, Dept of Developmental and Cell Biology).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.2 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'-GAGAGAGAGAGAGAGAGAGACTAGTCTCGAGTTTTTTTTTTTTTTTTTT-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Reference for library construction: Current Genomics 4, 635-644. Primers for sequencing: t3 or t7 for 3' end, sp6 for 5' end. Library constructed by Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine). Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >900 bp resulted in an average insert size of 1.1 kb. This primary library was constructed by Express Genomics (Frederick, MD). Use M13(-21) primer for 3' end reads, and m13rp for 5' end reads. Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.6 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.4 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

The library was prepared by oligo-dT priming (5'-GAGAGAGAGAGAGAGAGAGACTAGTCTCGAGTTTTTTTTTTTTTTTTTT-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.6 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1783 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Center (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Center (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Center (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Center (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_XGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Center (Vancouver, Canada). Note: this is a Xenopus Gene Collection library.

Library prepared from 5 ug of poly A+ RNA by oligo-dT priming [5'-ACTAGTGCGGCCGCCTAGGCCTCGAGT(18)-3'] and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and XhoI digestion, the cDNA was size-selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1 kb were ligated into EcoRI/XhoI digested pCS107 vector. Average insert size is 1.5 kb. The original library contained 1E5 recombinants. Reference: Current Genomics 4, 635-644. Use sp6 to obtain 5' end sequence, and t7 or t3 to obtain 3' end sequence. Library constructed by Bruce Blumberg (University of California, Irvine, Dept of Developmental and Cell Biology).

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.25 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.2 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

cDNA from 2 ug polyA+ mRNA, oligo dT-primed using 5'-ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTT-3'. Library was mass excised (from lambda-ZAPII) using ExAssist phage. The resulting single-stranded phagemids were used to infect TOP10F'. This library has been used successfully to clone a number of full-length cDNAs ranging in size from 1.4-4.5 kb. There are <0.5% clones with multiple inserts. One should be suspicious of any clone which gives 3 or more bands in an EcoRI/XhoI digest AND has an internal XhoI site. Library constructed and donated by B. Blumberg (University of California, Irvine); also referred to as Xenopus_laevis_ooctye_non_normalized.

cDNA from 2 ug polyA+ mRNA, oligo dT-primed using 5'-ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTT-3'. Library was mass excised (from lambda-ZAPII) using ExAssist phage. The resulting single-stranded phagemids were normalized by hybridization to biotinylated driver (prepared from the same library by PCR) to Cot11. After removal of hybrids and excess driver by streptavidin sepharose chromatography, the ss-phagemids were made double-stranded. Original library (X.laevis occytes, stages 5-6 mixed) constructed and donated by B. Blumberg (University of California, Irvine), normalization by J. Song.

cDNA made by oligo-dT priming. Library constructed in the laboratory of R. Harland, Ph.D. (University of California, Berkeley).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.0 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1408 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1745 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >900 bp resulted in an average insert size of 1.2 kb. This primary library was constructed by Express Genomics (Frederick, MD). Use M13(-21) primer for 3' end reads and m13rp for 5' reads. Note: this is a Xenopus Gene Collection library.

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1562 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 2.1 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.4 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

cDNA was primed using oligo-dT primer: 5'-GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25-3' and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.2kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.

The library was prepared from total RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1610 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 978 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.

5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.2kb (range 0.4-3.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a Xenopus Gene Collection library.

RNA obtained from 6 adult male testes. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.25 kb. This is a primary library (normalized primary library is NICHD_XGC_Te2N) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

RNA obtained from 6 adult male testes. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.15 kb. This primary, microquantity library is normalized to Cot5 (non-normalized primary library is NICHD_XGC_Te2) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 0.5-1.5 kb size fraction (additional size fractions contained in the NIH_XGC_tropTe4 and Te5 libraries). Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 1.5-2 kb size fraction (additional size fractions contained in the NIH_XGC_tropTe3 and Te5 libraries). Library constructed at the DOE Joint Genome Institute.

PolyA+ RNA was primed with oligo-dT primer 5'-GACTAGTTCTAGATCGCGAG CGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNA was ligated to SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3'), digested with NotI, size fractionated in 1.1% agarose gel electrophoresis and ligated into SalI and NotI digested pCMV-SPORT6 vector. Library contains the 2-3 kb size fraction (additional size fractions contained in the NIH_XGC_tropTe3 and Te4 libraries). Library constructed at the DOE Joint Genome Institute.

The library was prepared from total RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1364 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).

cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.

Bulk tissue was collected from a whole 10 month old male from the F6 strain. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for >1.5 kb fragments for an average insert size of 1.92 kb. A normalized version of this library is also available (NICHD_XGC_Swb1N). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Xenopus Gene Collection library.

Bulk tissue was collected from a whole 10 month old male from the F6 strain. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for >1.5 kb fragments for an average insert size of 1.92 kb. Library was normalized to Cot5 with a 180-fold reduction of actin. A non-normalized version of this library is also available (NICHD_XGC_Swb1). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Xenopus Gene Collection library.

5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.6 kb (range 0.9-3.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a Xenopus Gene Collection library.

5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.7 kb (range 0.8-3.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a Xenopus Gene Collection library.

The library was made from dT primed cDNA and cloned into vector pCS107. PolyA RNA were primed with an oligo dT primer (5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT -3'), ligated to a SalI adapter (5'-TCGACCCACGCGTCCG-3' and 5'-CGGACGCGTGGG-3') and digested with NotI. cDNA was size selected using 1.1% agarose gel electrophoresis (>0.6kb) then ligated into NotI and SalI digested pCS107 vector. Primary library, non-amplified. Library constructed at the DOE Joint Genome Institute (Walnut Creek, CA) as part of the Xenopus Gene Collection project.

Library constructed by Dr. B. Korn and Sabine Henze (RZPD).