mRNA made from flow-sorted lymphocytes, cDNA made by oligo-dT priming. Directionally cloned. Average insert size 1.8 kb. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTGGTTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized; constructed by Bento Soares and M.Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGGATTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 20 blastocysts. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 0.2 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC- 3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

mRNA made from bone marrow progenitors, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from bone marrow progenitors, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from flow-sorted, bone marrow progenitors, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH (http://lgsun.grc.nia.nih.gov/cDNA). This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Dr. Akihiro Umezawa (Keio University School of Medicine, Japan). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 2.1 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.0 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Akihiro Umezawa (Keio University School of Medicine, Japan). Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2.1 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGCCGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo (University of Iowa).

cDNA made by oligo-dT priming. Library amplified by stretch PCR. Subtraction method: Bonaldo, et al., Genome Research 6:791. Library constructed by Dr. Archibald Perkins (Yale University).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [AATTCGTCGACATC], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation). Source irradiated bowel harvested 72 hours after irradiation (1400 Gys).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGGATCCTTC 3' and 5' GAAGGATCCG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Cloned unidirectionally. Primer: Oligo dT. pCMV-SPORT2 vector. *COMMENT: Sequence analysis indicates this library is likely to be of rat origin.

Cloned unidirectionally. Primer: Oligo dT. Size-selected 1.5 kb for average insert size 2 kb. Primary library; non-amplified. This library was constructed by M. Mione (University College London, Dept of Anatomy and Developmental Biology).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5' -ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.08 kb (range 0.73-1.37 kb). 13/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA).

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 0.5-1 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 2-3 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 2-3 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc, containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 3-4 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 1-2 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 4-5 kb fragments), containing 210,000 recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 3-4 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 2-3 kb fragments), containing 3.5 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 3-4 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 4-5 kb fragments. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 5-7 kb fragments. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 0.5-1 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 1-2 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 3-4 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 2-3 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project..

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 4-5 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 5-7 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 0.5-1 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains existing tissue from LIB_ID 956). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 2-3 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCAC GACTTTTTTTTTTTTTTTTTT -3')contains the sequence tag CAGCCACGAC between the NotI cloning siteand dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 0.5-1 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 3-4 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 1-2 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 4-5 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue, adult days 1, 5 and 15 (size selected). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTTT-3')contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Size-selected for the 4-5 kb fraction. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy Project (BMAP).

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 5-7 kb fraction). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue, adult days 1, 5 and 15 (size selected). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTTT-3')contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy Project (BMAP).

Non-normalized full-length enriched library from pooled mouse brain tissue days 1, 5 and 15. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue days 1, 5 and 15. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue days 1, 5 and 15. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

' cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.2-0.5 kb size fraction (other fractions present in NIH_MGC_144). Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library. '

' cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.2-0.5 kb size fraction (other fractions present in NIH_MGC_143). Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library. '

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_378 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_377 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_380 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_379 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCACGCGTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a NotI- oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGAATAATACATTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacII vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a NotI- oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCTGTACCGATGTTTTTTTTTTTTTTTTTTT-3'; double- stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a NotI- oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGGCGCTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacII vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGTATCCATGATTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' AND 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCAAGGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Wolfgang Liedtke. Library went through two rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [AATTCGGATCCTTC], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Tissue obtained from 8 week old mouse. Colon was harvested 72hours after irradiation with 1400 Gys. 1st strand cDNA was primed with a Not I - oligo(dT) primer [5'TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGTCGACATG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Double-stranded cDNA was prepared from cell line MAC13 usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Double-stranded cDNA was prepared from cell line MAC16 usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Cloned unidirectionally from mRNA prepared from diaphragm muscle. Primer: Oligo dT. Average insert size: 1.5 kb. Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally from mRNA prepared from 5000 unfertilized eggs. Primer: SalI(dT): 5'-CGGTCGACCGTCGACCGTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the MluI/SalI sites of a modified pBluescribe vector using commercial linkers (NEB). Average insert size: 1.0 kb.

Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH (http://lgsun.grc.nia.nih.gov/cDNA). This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from a pool of 1488 unfertilized eggs. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'], treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 148 unfertilized eggs. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'), treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

cDNA made by oligo-dT priming. Directionally cloned into SalI/NotI sites using the following 5' adaptor: 5'-TCGACCCACGCGTCCG-3'. Size-selected for average insert size 1.8-1.9 kb. Library constructed by J. Baker (Stanford University).

cDNA made by oligo-dT priming. Directionally cloned into SalI/NotI sites using the following 5' adaptor: 5'-TCGACCCACGCGTCCG-3'. Size-selected for average insert size 1.8-1.9 kb. Library constructed by J. Baker (Stanford University).

Cloned unidirectionally. Primer: Oligo dT. Gastrulating embryos were collected at 7.5dpc from C57BL6 x DBA matings, excluding embryos that had developed head folds and all extraembryonic tissues. Average insert size: 1.3 kb (range: 0.5 - 3.0 kb) Reference: Development 121, 2479-2489 (1995).

Cloned unidirectionally from mRNA prepared from limb bud tissue at 11.5 days post-conception. Primer: Oligo dT. cDNAs were cloned into the XbaI/XhoI sites of pBluescript SK+ (Stratagene) using commercial linkers (NEB). Average insert size: 1.0 kb.

Cloned unidirectionally from mRNA prepared from 13,500 2-cell stage embryos. Primer: SalI(dT): 5'-CGGTCGACCGTCGACCGTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the MluI/SalI sites of a modified pBluescribe vector using commercial linkers (NEB). Average insert size: 1.2 kb.

Cloned unidirectionally from mRNA prepared from primitive streak embryonic tissue. Primer: Oligo dT. cDNAs were cloned into the XbaI/XhoI sites of pBluescript SK+ (Stratagene) using commercial linkers (NEB). Average insert size: 1.0 kb.

Cloned unidirectionally from mRNA prepared from 2,000 8-cell stage embryos. Primer: NotI(dT): 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the NotI/SalI sites of a pSPORT vector (Life Technologies). Average insert size: 0.7 kb.

Cloned unidirectionally from mRNA prepared from 6.5 dpc embryo. Primer: SalI(dT): 5'-CGGTCGACCGTCGACCGTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the MluI/SalI sites of a modified pBluescribe vector using commercial linkers (NEB).

Cloned unidirectionally from mRNA prepared from 800 blastocysts. Primer: NotI(dT): 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the NotI/SalI sites of a pSPORT vector (Life Technologies). Two different size selections: B1 (larger inserts) and B3. Average insert size of combined library is 1 kb.

Cloned unidirectionally from mRNA prepared from inner cell mass embryonic tissue. Primer: Oligo dT. cDNAs were cloned into the XbaI/XhoI sites of pBluescript SK+ (Stratagene) using commercial linkers (NEB). Average insert size: 0.5 kb.

Total RNAs were extracted from 11.5 dpc embryos (excluding placenta and yolk sac). The double-stranded cDNA was synthesized with an oligo (dT)-1 primer GAGAGAGACTAGTTCTAGATCGCGAGCGGCCGCTTTTTTTTTTTTTTTTTT 3'. The cDNAs were ligated to LL-Sal3A: 5' GCTATTGACGTCGACTATCC 3' and LL-Sal3B: 5' GGATAGTCGACGTCAAT 3'. The cDNAs were size-selected and amplified by long-range PCR using Ex Taq polymerase for 18 cycles. The PCR-amplifiable cDNA mixture went through one round of equalization and was digested with SalI/NotI and cloned into the SalI/NotI sites of the pSPORT1 plasmid vector (Life Technologies). The library was constructed by Dr. Minoru S. H. Ko and Dr. Xiaohong Wang.

Cloned unidirectionally. Primer: Oligo dT. 10.5dpc embryos. pCMV-SPORT2 vector.

Cloned unidirectionally. Primer: Oligo dT. 13.5dpc embryos. pCMV-SPORT2 vector.

Cloned unidirectionally. Primer: Oligo dT. 15.5dpc embryos. pCMV-SPORT2 vector.

Cloned unidirectionally. Primer: Oligo dT. 8.5dpc embryos. pCMV-SPORT2 vector.

mRNA made from primitive streak, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of four embryos at 7.5 days postcoitum. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 7 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 13 embryos at 8.5 days postcoitum. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 9.1 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from a pool of 8 embryos at 10.5-days postcoitum. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.4Kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from a pool of 3 embryos at 11.5-days postcoitum. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.3Kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from 1 embryo at 13.5-days postcoitum. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 35g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.0Kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was obtained from a pool of seven embryos at 6.5 days post-conception. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 0.53 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pCMV-SPORT6 plasmid vector. The average insert size is about 2.3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 16 embryos at 9.5 days postcoitum. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 6 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). The mRNAs were extracted from a pool of 360 embryos at 8-cell stage. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 18ng of mRNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.7Kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). The mRNAs were extracted from a pool of 360 embryos at 4-cell stage. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 10.8ng of mRNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.2Kb. The library was constructed by Yulan Piao.

'Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.7 kb. Constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library. '

'Normalized, full-length enriched library from pool of mouse embronic limb, maxilla and mandible, embryonic day 17.5, 18.5 and newborn (mandible (5, 4 and 1 limb and jaw equivalents from respective days). Cloned directionally, oligo-dT primed (5''-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3''. Size selected for the 1kb fragments, average insert size 1.2 kb. Normalization to Cot 7.5 . Tissue contributed by David Rowe; library constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library. '