mRNA made from flow-sorted lymphocytes, cDNA made by oligo-dT priming. Directionally cloned. Average insert size 1.8 kb. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTGGTTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized; constructed by Bento Soares and M.Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGGATTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 20 blastocysts. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 0.2 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC- 3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

mRNA made from bone marrow progenitors, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from bone marrow progenitors, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from flow-sorted, bone marrow progenitors, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH (http://lgsun.grc.nia.nih.gov/cDNA). This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Dr. Akihiro Umezawa (Keio University School of Medicine, Japan). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 2.1 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.0 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Akihiro Umezawa (Keio University School of Medicine, Japan). Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2.1 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGCCGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo (University of Iowa).

cDNA made by oligo-dT priming. Library amplified by stretch PCR. Subtraction method: Bonaldo, et al., Genome Research 6:791. Library constructed by Dr. Archibald Perkins (Yale University).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [AATTCGTCGACATC], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation). Source irradiated bowel harvested 72 hours after irradiation (1400 Gys).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGGATCCTTC 3' and 5' GAAGGATCCG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Cloned unidirectionally. Primer: Oligo dT. pCMV-SPORT2 vector. *COMMENT: Sequence analysis indicates this library is likely to be of rat origin.

Cloned unidirectionally. Primer: Oligo dT. Size-selected 1.5 kb for average insert size 2 kb. Primary library; non-amplified. This library was constructed by M. Mione (University College London, Dept of Anatomy and Developmental Biology).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5' -ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.08 kb (range 0.73-1.37 kb). 13/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA).

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 0.5-1 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 2-3 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 2-3 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc, containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 3-4 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 1-2 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 18.5pc (size selected for the 4-5 kb fragments), containing 210,000 recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 3-4 kb fragments), containing 3 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 2-3 kb fragments), containing 3.5 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 3-4 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 4-5 kb fragments. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 5-7 kb fragments. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 0.5-1 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 1-2 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 3-4 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 2-3 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project..

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 4-5 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 12.5pc (size selected for the 5-7 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains the same tissue as NIH_BMAP_FA0). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares(University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue day 15.5pc (size selected for the 0.5-1 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCACGACTTTTTTTTTTTTTTTTTT -3') contains the sequence tag CAGCCACGAC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. (Contains existing tissue from LIB_ID 956). Tissue was obtained from the Jim Lin lab at the University of Iowa,library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 2-3 kb fragments), containing 2.2 million recombinants. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCAGCCAC GACTTTTTTTTTTTTTTTTTT -3')contains the sequence tag CAGCCACGAC between the NotI cloning siteand dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 0.5-1 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 3-4 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 1-2 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 4-5 kb fragments). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue, adult days 1, 5 and 15 (size selected). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTTT-3')contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Size-selected for the 4-5 kb fraction. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy Project (BMAP).

Non-normalized full-length enriched library from pooled mouse brain tissue embryonic day, 13.5, 14.5, 16.5 and 17.5 (size selected for the 5-7 kb fraction). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAGCGAGACAGTTTTTTTTTTTTTTTTTT-3')contains the sequence tag AGCGAGACAG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Tissue was obtained from the Jim Lin lab at the University of Iowa, library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue, adult days 1, 5 and 15 (size selected). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTTT-3')contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy Project (BMAP).

Non-normalized full-length enriched library from pooled mouse brain tissue days 1, 5 and 15. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue days 1, 5 and 15. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse brain tissue days 1, 5 and 15. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

' cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.2-0.5 kb size fraction (other fractions present in NIH_MGC_144). Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library. '

' cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.2-0.5 kb size fraction (other fractions present in NIH_MGC_143). Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library. '

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_378 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_377 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_380 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_379 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCACGCGTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a NotI- oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGAATAATACATTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacII vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a NotI- oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCTGTACCGATGTTTTTTTTTTTTTTTTTTT-3'; double- stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a NotI- oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGGCGCTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacII vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGTATCCATGATTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' AND 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCAAGGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Wolfgang Liedtke. Library went through two rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [AATTCGGATCCTTC], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Tissue obtained from 8 week old mouse. Colon was harvested 72hours after irradiation with 1400 Gys. 1st strand cDNA was primed with a Not I - oligo(dT) primer [5'TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGTCGACATG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Double-stranded cDNA was prepared from cell line MAC13 usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Double-stranded cDNA was prepared from cell line MAC16 usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Cloned unidirectionally from mRNA prepared from diaphragm muscle. Primer: Oligo dT. Average insert size: 1.5 kb. Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally from mRNA prepared from 5000 unfertilized eggs. Primer: SalI(dT): 5'-CGGTCGACCGTCGACCGTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the MluI/SalI sites of a modified pBluescribe vector using commercial linkers (NEB). Average insert size: 1.0 kb.

Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH (http://lgsun.grc.nia.nih.gov/cDNA). This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from a pool of 1488 unfertilized eggs. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'], treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 148 unfertilized eggs. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'), treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

cDNA made by oligo-dT priming. Directionally cloned into SalI/NotI sites using the following 5' adaptor: 5'-TCGACCCACGCGTCCG-3'. Size-selected for average insert size 1.8-1.9 kb. Library constructed by J. Baker (Stanford University).

cDNA made by oligo-dT priming. Directionally cloned into SalI/NotI sites using the following 5' adaptor: 5'-TCGACCCACGCGTCCG-3'. Size-selected for average insert size 1.8-1.9 kb. Library constructed by J. Baker (Stanford University).

Cloned unidirectionally. Primer: Oligo dT. Gastrulating embryos were collected at 7.5dpc from C57BL6 x DBA matings, excluding embryos that had developed head folds and all extraembryonic tissues. Average insert size: 1.3 kb (range: 0.5 - 3.0 kb) Reference: Development 121, 2479-2489 (1995).

Cloned unidirectionally from mRNA prepared from limb bud tissue at 11.5 days post-conception. Primer: Oligo dT. cDNAs were cloned into the XbaI/XhoI sites of pBluescript SK+ (Stratagene) using commercial linkers (NEB). Average insert size: 1.0 kb.

Cloned unidirectionally from mRNA prepared from 13,500 2-cell stage embryos. Primer: SalI(dT): 5'-CGGTCGACCGTCGACCGTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the MluI/SalI sites of a modified pBluescribe vector using commercial linkers (NEB). Average insert size: 1.2 kb.

Cloned unidirectionally from mRNA prepared from primitive streak embryonic tissue. Primer: Oligo dT. cDNAs were cloned into the XbaI/XhoI sites of pBluescript SK+ (Stratagene) using commercial linkers (NEB). Average insert size: 1.0 kb.

Cloned unidirectionally from mRNA prepared from 2,000 8-cell stage embryos. Primer: NotI(dT): 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the NotI/SalI sites of a pSPORT vector (Life Technologies). Average insert size: 0.7 kb.

Cloned unidirectionally from mRNA prepared from 6.5 dpc embryo. Primer: SalI(dT): 5'-CGGTCGACCGTCGACCGTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the MluI/SalI sites of a modified pBluescribe vector using commercial linkers (NEB).

Cloned unidirectionally from mRNA prepared from 800 blastocysts. Primer: NotI(dT): 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the NotI/SalI sites of a pSPORT vector (Life Technologies). Two different size selections: B1 (larger inserts) and B3. Average insert size of combined library is 1 kb.

Cloned unidirectionally from mRNA prepared from inner cell mass embryonic tissue. Primer: Oligo dT. cDNAs were cloned into the XbaI/XhoI sites of pBluescript SK+ (Stratagene) using commercial linkers (NEB). Average insert size: 0.5 kb.

Total RNAs were extracted from 11.5 dpc embryos (excluding placenta and yolk sac). The double-stranded cDNA was synthesized with an oligo (dT)-1 primer GAGAGAGACTAGTTCTAGATCGCGAGCGGCCGCTTTTTTTTTTTTTTTTTT 3'. The cDNAs were ligated to LL-Sal3A: 5' GCTATTGACGTCGACTATCC 3' and LL-Sal3B: 5' GGATAGTCGACGTCAAT 3'. The cDNAs were size-selected and amplified by long-range PCR using Ex Taq polymerase for 18 cycles. The PCR-amplifiable cDNA mixture went through one round of equalization and was digested with SalI/NotI and cloned into the SalI/NotI sites of the pSPORT1 plasmid vector (Life Technologies). The library was constructed by Dr. Minoru S. H. Ko and Dr. Xiaohong Wang.

Cloned unidirectionally. Primer: Oligo dT. 10.5dpc embryos. pCMV-SPORT2 vector.

Cloned unidirectionally. Primer: Oligo dT. 13.5dpc embryos. pCMV-SPORT2 vector.

Cloned unidirectionally. Primer: Oligo dT. 15.5dpc embryos. pCMV-SPORT2 vector.

Cloned unidirectionally. Primer: Oligo dT. 8.5dpc embryos. pCMV-SPORT2 vector.

mRNA made from primitive streak, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of four embryos at 7.5 days postcoitum. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 7 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 13 embryos at 8.5 days postcoitum. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 9.1 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from a pool of 8 embryos at 10.5-days postcoitum. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.4Kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from a pool of 3 embryos at 11.5-days postcoitum. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.3Kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were extracted from 1 embryo at 13.5-days postcoitum. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 35g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.0Kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was obtained from a pool of seven embryos at 6.5 days post-conception. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 0.53 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pCMV-SPORT6 plasmid vector. The average insert size is about 2.3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library. Total RNA was extracted from a pool of 16 embryos at 9.5 days postcoitum. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 6 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). The mRNAs were extracted from a pool of 360 embryos at 8-cell stage. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 18ng of mRNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.7Kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). The mRNAs were extracted from a pool of 360 embryos at 4-cell stage. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 10.8ng of mRNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.2Kb. The library was constructed by Yulan Piao.

'Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.7 kb. Constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library. '

'Normalized, full-length enriched library from pool of mouse embronic limb, maxilla and mandible, embryonic day 17.5, 18.5 and newborn (mandible (5, 4 and 1 limb and jaw equivalents from respective days). Cloned directionally, oligo-dT primed (5''-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3''. Size selected for the 1kb fragments, average insert size 1.2 kb. Normalization to Cot 7.5 . Tissue contributed by David Rowe; library constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library. '

' Non-normalized full-length enriched library from pooled mouse embryonic limb, maxilla and mandible, day 10.5 and 11.5. Oligo-dT primed (5''- GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)16-3''), directionally cloned, size selected for the 0.5-1 kb fragments; average insert size 1.8 kb. Tissue contributed by David Rowe. Library constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library. '

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_410 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_409 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_412 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_411 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTTATTTTTTTTTTTTTTTTTT 3'], on total mouse RNA [provided by Minoru Ko, Wayne State Univ.]; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATGCATTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGGAAATTTTTTTTTTTTTTTTTTTTTTTTT 3'], on equal amounts of mRNA from 2 13.5dpc and 2 14.5dpc embryos [total RNA provided by Minoru Ko, Wayne State Univ., from 2 ]; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATGTTTTTTTTTTTTTTTTTTT 3'], on total mouse RNA [provided by Minoru Ko, Wayne State Univ.]; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

Cloned unidirectionally. Primer: Oligo dT. P19 cell line treated with retinoic acid. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. P19 cell line. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA. REFERENCES: Suzuki, Y., Yoshitomo, K., Maruyama, K., Suyama, A., and Sugano, S. Construction and characterization of a full length-enriched and a 5' end enriched cDNA library. Gene 200, 149-156, 1997. Sasaki, Z., Suzuki, Y., Watanabe, M., Imai, J., Shibui, A., Yoshida, K., Hata. H., Yamaguchi, R., Tateyama, S., and Sugano, S. Construction of mouse full length-enriched cDNA libraries by oligo-capping. DNA Research, submitted.

Cloned unidirectionally from mRNA prepared from 800 ES cells. Primer: SalI(dT): 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'. cDNAs were cloned into the NotI/SalI sites of a pSPORT vector (Life Technologies). Average insert size 1.3 kb.

This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Kenneth R. Boheler (National Insitute on Aging, USA). ES cells were cultured without feeder cells in the absence of LIF for 4 or 18 hours. Equimolar mixtures of these RNA samples were used for library construction. Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'), treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.4 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). ES cells were plated at density 3x104/cm2, on gelatin-coated plates and cultured for 48 hrs at 37 OC, 5% CO2. Culture medium: DMEM supplemented with 15% FBS, 2 mM L-glutamine, 0.1 mM NEAA, 1mM Sodium pyruvate, 0.1 mM beta-mercaptoethanol, 1000 U/ml LIF, 100 U/ml penicillin, and 100 ug/ml streptomycin. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.7 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). ES cells were plated at density 3x104/cm2, on gelatin-coated plates and cultured for 48 hrs at 37 OC, 5% CO2. Culture medium: DMEM supplemented with 15% FBS, 2 mM L-glutamine, 0.1 mM NEAA, 1mM Sodium pyruvate, 0.1 mM beta-mercaptoethanol, 100 U/ml penicillin, and 100 ug/ml streptomycin. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.4 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). ES cells were plated at density 3x103/cm2, on gelatin-coated plates and cultured for 48 hrs at 37 OC, 5% CO2. Culture medium: DMEM supplemented with 15% FBS, 2 mM L-glutamine, 0.1 mM NEAA, 1mM Sodium pyruvate, 0.1 mM beta-mercaptoethanol, 100 U/ml penicillin, and 100 ug/ml streptomycin. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 25g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.8 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Kenneth R. Boheler (National Insitute on Aging, USA). ES cells were cultured without feeder cells in the presence of LIF and BRL-conditioned media. Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 14.2 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.4 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH (http://lgsun.grc.nia.nih.gov/cDNA). This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Dr. Kenneth R. Boheler (National Institute on Aging, USA). ES cells were cultured without feeder cells in the presence of LIF and BRL-conditioned media. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 14.2 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.4 kb. The library was constructed by Yulan Piao.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATTGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through two rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

Non-normalized full-length enriched library from pooled mouse eye tissue, embryonic days 15, 16, 17 and 18. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCTGCGTCCTCTTTTTTTTTTTTTTTTTT-3') contains the sequence tag CTGCGTCCTC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse eye tissue, embryonic days 15, 16, 17 and 18. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCTGCGTCCTCTTTTTTTTTTTTTTTTTT-3') contains the sequence tag CTGCGTCCTC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5 (size selected for 4-5 kb). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse eye tissue embryonic days 12.5, 13.5 and 14.5 (size selected for 5-7 kb). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCTTATTGAAGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag TTATTGAAGT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled mouse eye Tissue, embryonic days 15, 16, 17 and 18. The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCTGCGTCCTCTTTTTTTTTTTTTTTTTT-3') contains the sequence tag CTGCGTCCTC between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from whole eye (pooled postnatal days 1, 5 and 15). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from whole eye (pooled postnatal days 1, 5 and 15). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from whole eye (pooled postnatal days 1, 5 and 15). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from whole eye (pooled postnatal days 1, 5 and 15 and embryonic 15.5-16, 16.5, 17.5 and 18.5 dpc). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from whole eye (pooled embryonic days 15.5-16, 16.5, 17.5 and 18.5). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCXXXXXXXXXXTTTTTTTTTTTTTTTTTT-3') contains the sequence tags CTGCGTCCTC or AGAGGAGACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from whole eye (pooled embryonic days 15.5-16, 16.5, 17.5 and 18.5). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCXXXXXXXXXXTTTTTTTTTTTTTTTTTT-3') contains the sequence tags CTGCGTCCTC or AGAGGAGACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from whole eye (pooled juvenile days 1, 5 and 15 and embryonic days 15, 16, 17 and 18). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from whole eye (pooled embryonic days 15.5-16, 16.5, 17.5 and 18.5). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCAATAATTACGTTTTTTTTTTTTTTTTTTT-3') contains the sequence tag AATAATTACG between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

'Cloned unidirectionally; oligo-dT primed. Average insert size 3.3 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

mRNA made from developing eye tissue, cDNA made by oligo-dT priming with NotI oligo. SalI adaptor (5'-TCGACCCACGCGTCCG-3') ligated to 5' ends. Size-selected with cDNA size fractionation resin, average insert size 1.3 kb. Primary library, non-amplified. Library constructed by Dr. Pen Rashbass (penr@hgu.mrc.ac.uk).

mRNA made from developing eye tissue, cDNA made by oligo-dT priming with NotI oligo. SalI adaptor (5'-TCGACCCACGCGTCCG-3') ligated to 5' ends. Size-selected with cDNA size fractionation resin, average insert size 1.3 kb. Primary library, non-amplified. Library constructed by Dr. Pen Rashbass (penr@hgu.mrc.ac.uk).

This is a long-transcript enriched cDNA library. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 1.8 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.4 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Mark G. Carter (NIH/NIA-IRP). EG cells were cultured at 37C, 5%CO2 in DMEM supplemented with 15% ES cell-qualified FBS, 0.1mM non-essential amino acids, 2mM glutamine, penicillin/streptomycin, 1mM sodium pyruvate, 0.1mM beta- mercaptoethanol, and 10e7 units of LIF per liter. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2.5 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 4 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH (http://lgsun.grc.nia.nih.gov/cDNA). This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). EG cells were obtained from Dr. Brigid L.M. Hogan and RNA was prepared by Dr. Mark G. Carter (NIH/NIA-IRP). EG cells were cultured at 37? C, 5% CO2 in DMEM supplemented with 15% ES cell-qualified FBS, 0.1mM non-essential amino acids, 2 mM glutamine, penicillin/streptomycin, 1 mM sodium pyruvate, 0.1 mM beta-mercaptoethanol, and 10^7 units of LIF per liter. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 2.5 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were double digested with Not1 and Sal1 enzymes, then purified by phenol/chloroform and Centricon 100. The cDNA mixture was subjected to a special subtraction procedure by Dr.Kazuhiro Kondo at AISIN Cosmos. Then the subtracted cDNAs were cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.2kb. The library was constructed by Yulan Piao and Kazuhiro Kondo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATTTCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through two rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc) (size selected for 2-3 kb). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc) (size selected for 0.5-1 kb). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc) (size selected for 1-2 kb). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

Non-normalized full-length enriched library from pooled upper head including skull, brain, and eye (9.5 dpc) and skull and eye (10.5 dpc). The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first- synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCCCGAACTGAATTTTTTTTTTTTTTTTTT-3') contains the sequence tag CGAACTGAAT between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library construction by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa) for the NIH Brain Mouse Anatomy (BMAP) Project.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGGATCCAAG and CTTGGATTCG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.54 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAAAGTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Minoru Ko, Wayne State Univ. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

Cloned unidirectionally. Primer: Oligo dT. 93 pooled NIH/Swiss 13 day embryo hearts. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

'Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.95 kb. Constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library. '

The organ of Corti (OC) was fine dissected from a total of 386 OC as follows: 102 samples from post-natal (P) day 5; 72 from P6; 60 from P7; 46 from P8; 18 from P9; 20 from P10; 14 from P12 and 24 from P13. Total RNA was extracted using the micro Fasttrack kit (catalog # K1593-02; Invitrogen, Carlsbad, CA), according to manufacturer's instructions. Reverse transcription and library construction were carried out with the Uni-Zap XR vector kit (catalog # 237211, Stratagene) and Uni-Zap XR Gigapack III Gold Cloning kit (catalog # 237612), both from Stratagene (La Jolla, CA, USA), according to manufacturer's instructions. The frequency distribution of the library is as follows: 72% of genes have 1 copy; 14.3% 2; 12% 3-10; 1.4% 11-50 and 0.1% 51-150. As to gene function, 45% of genes are present in GenBank and have know function; 23% have hits in GenBank,but do not have assigned function; 12% are uncharacterized ESTs and 20% are unidentified. Library created in the laboratory of M. Brownstein (NIMH, NIH). A complete library decription can be found at NCBI.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACACTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed and donated by Bento Soares and M.Fatima Bonaldo (University of Iowa) and R. Hardisty, A. Varela-Carver, P. Mburu and S.D.M. Brown (MRC UK Mouse Genome Centre and Mammalian Genetics Unit, Harwell, UK).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5'-TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT-3']; double-stranded cDNA was ligated to Eco RI adaptors [5'-AATTCGGATCCAAG-3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Cloned unidirectionally. Primer: Oligo dT. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Library provided by David Beier and Lisa Guay-Woodford.

Cloned unidirectionally. Primer: Oligo dT. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Library provided by David Beier and Lisa Guay-Woodford.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.75 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH (http://lgsun.grc.nia.nih.gov/cDNA). This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). In brief, double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 26 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.0 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3') from 26 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 3 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

cDNA made by oligo-dT with attB2 site and directionally cloned. Priming sequence: 5'-TTTCCTGCAGGCCGGCCACCACTTTGTACAAGAAAGCTGGGTTTTTTTTTTTTTTTTTTT-3'. Full-length enriched library was constructed using the GeneRacer kit by Invitrogen, library amplification 16 cycles. Library constucted by Mark Bittinger in the Bradfield laboratory (McArdle Laboratory for Cancer Research, University of Wisconsin). Note: this is a NIH_MGC Library.

' cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5 kb size fraction. Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library. '

Cloned unidirectionally. Primer: Oligo dT. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA. REFERENCES: Suzuki, Y., Yoshitomo, K., Maruyama, K., Suyama, A., and Sugano, S. Construction and characterization of a full length-enriched and a 5' end enriched cDNA library. Gene 200, 149-156, 1997. Sasaki, Z., Suzuki, Y., Watanabe, M., Imai, J., Shibui, A., Yoshida, K., Hata. H., Yamaguchi, R., Tateyama, S., and Sugano, S. Construction of mouse full length-enriched cDNA libraries by oligo-capping. DNA Research, submitted.

' Normalized full-length enriched library from pooled mouse embryonic limb, maxilla and mandible, day 12.5, 13.5, 14.5, and 15.5. Oligo-dT primed (5''- GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)16-3''), directionally cloned, size selected for the 0.5-1 kb fragments; average insert size 1.6 kb. Normalized to Cot 7.5. Tissue contributed by David Rowe. Library constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library. '

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.9 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

cDNA made by oligo-dT with attB2 site and directionally cloned. Priming sequence: 5'-TTTCCTGCAGGCCGGCCACCACTTTGTACAAGAAAGCTGGGTTTTTTTTTTTTTTTTTTT-3'. Full-length enriched library was constructed using the GeneRacer kit by Invitrogen, library amplification 16 cycles. Library constucted by Mark Bittinger in the Bradfield laboratory (McArdle Laboratory for Cancer Research, University of Wisconsin). Note: this is a NIH_MGC Library.

' cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5 kb size fraction. Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAATCTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA. REFERENCES: Suzuki, Y., Yoshitomo, K., Maruyama, K., Suyama, A., and Sugano, S. Construction and characterization of a full length-enriched and a 5' end enriched cDNA library. Gene 200, 149-156, 1997. Sasaki, Z., Suzuki, Y., Watanabe, M., Imai, J., Shibui, A., Yoshida, K., Hata. H., Yamaguchi, R., Tateyama, S., and Sugano, S. Construction of mouse full length-enriched cDNA libraries by oligo-capping. DNA Research, submitted.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5'-TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT-3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGGATCCATC and GATGGATTCG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Cloned unidirectionally. Primer: Oligo dT. Average insert 1.9 kb. Library constructed by Life Technologies, catalog #12023-016. Investigator providing samples: Gilbert Smith, NIH Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert 1.5 kb. Library constructed by Life Technologies, catalog #12024-014. Investigator providing samples: Gilbert Smith, NIH Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from mRNA obtainedfrom pooled lung tumors with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTCTGTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa). Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

cDNA made by oligo-dT with attB2 site and directionally cloned. Priming sequence: 5'-TTTCCTGCAGGCCGGCCACCACTTTGTACAAGAAAGCTGGGTTTTTTTTTTTTTTTTTTT-3'. Full-length enriched library was constructed using the GeneRacer kit by Invitrogen, library amplification 16 cycles. Library constucted by Mark Bittinger in the Bradfield laboratory (McArdle Laboratory for Cancer Research, University of Wisconsin). Note: this is a NIH_MGC Library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_414 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_413 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_416 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_415 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. 6-8 month old female lung and 1.5 year old male lung were source of mRNA. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATACTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Bertrand Jordan. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

Cloned unidirectionally. Primer: Oligo dT. WEHI-3 cell line. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3'

Cloned unidirectionally. Primer: Oligo dT. Average insert 1.7 kb. Library constructed by Life Technologies, catalog #12015-012. Investigator providing samples: Gilbert Smith, NIH Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from mRNA obtainedfrom pooled mammary gland tumors with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACTAGTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa). Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert 1.7 kb. Library constructed by Life Technologies, catalog #12016-010. Investigator providing samples: Gilbert Smith, NIH Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert 2 kb. Library constructed by Life Technologies, catalog #12017-018. Investigators providing samples: Lothar Hennighausen/Chu-Xia Deng, NIH Reference for transgenic model: Xu et al., Nature Genetics 22, 37-43 (1999). Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert 2.5 kb. Library constructed by Life Technologies, catalog # 12018-016. Investigators providing samples: Lothar Hennighausen/Priscilla Furth, NIH Reference for transgenic model: Li et al., Cell Growth and Differentiation 7, 3-11 (1996). Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert 2 kb. Library constructed by Life Technologies, catalog #12019-014. Investigators providing samples: Lothar Hennighausen/Robin Humphreys, NIH Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert 2.6 kb. Library constructed by Life Technologies, catalog #120222-018. Investigator providing samples: Jeffrey Green, M.D., NIH Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from mammary gland tissue from a lactating female, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTTCTTTTTTTTTTTTTTTTTTTTTTTT-3'. Double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Library was constructed by Bento Soares and M. Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAATGGTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Minoru Ko, Wayne State Univ. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTTAATTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGCGCTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.

Cloned unidirectionally. Primer: Oligo dT. From M2 cells, a highly metastatic derivative of the K-1735 (mouse) melanoma. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGGATCCAAC and GTTGGATTCG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

' cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5 kb size fraction. Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library. '

Library was constructed from RT-PCR products. Inserts are cloned into the TOPO site and oriented with 5' end nearest the SpeI site and 3' end nearest the PstI site. Inserts can be excised using EcoRI. Companion library NIH_MGC_285 has clones in the opposite orientation. Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a NIH_MGC Library

Library was constructed from RT-PCR products. Inserts are cloned into the TOPO site and oriented with 5' end nearest the PstI site and 3' end nearest the SpeI site. Inserts can be excised using EcoRI. Companion library NIH_MGC_284 has clones in the opposite orientation. Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a NIH_MGC Library

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_390 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_389 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_392 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_391 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_394 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_393 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_396 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_395 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGTCGACAAG 3' and 5' CTTGTCGACG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [5' AATTCGTCGACAAG 3' and 5' CTTGTCGACG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [AATTCGGATCCTTG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation). The C2C12 cell line (available from ATCC, catalog # CRL-1772) differentiates rapidly, forming contractile myotubes and producing characteristic muscle proteins.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [AATTCGTCGACAAG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation). Source undifferentiated tissue culture cell line C2C12. Library constructed by Bob Barstead. The C2C12 cell line (available from ATCC, catalog # CRL-1772) differentiates rapidly, forming contractile myotubes and producing characteristic muscle proteins.

1st strand cDNA was prepared from medial nasal process tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGAGCATTTCTTTTTTTTTTTTTTTTTTTTTTTT-3'. Double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Library was constructed by Bento Soares and M. Fatima Bonaldo.

'Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.2 kb. Constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library. '

Olfactory receptor cDNAs from adult mouse (RNA provided by Leslie Vosshall; clones selected by screening olfactory receptor cDNA libraries at low stringency with probes prepared by degenerate PCR, using primers to conserved sequences of the olfactory receptor gene family (Genome Biology 4:R71, and provided by Janet Young, Fred Hutchinson Cancer Research Center) were used as the starting template. 8 ul of each clone was inoculated in 1 ml LB containing the appropriate antibiotic. A BP recombinational reaction contains 2 ul of 5 X BP3 buffer; 2 ul of BP clonase; 1 ul of pDONR223 (150 ng/uL); 2 ul of PCR product (2-200 ng/uL); 3 uL H2O. The 5 X BP3 buffer consists of 100 mM Tris-Cl (pH 7.5); 20 mM EDTA; 30 mM spermidine-HCL; 25 percent glycerol; 225 mM NaCl. LR reactions we performed as described previously with minor changes (Reboul et al. 2003, Rual et al. 2004). BP products were transformed into liquid cultures of E. coli, with antibiotic selection of spectinomycin at 50 ug/mL. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGC-ORF-TTGccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Dana Farber Cancer Institute, Center for Cancer Systems Biology for the ORFeome Collaboration .

Olfactory receptor cDNAs from embryonic 16.5-18.5 day mouse (RNA provided by Tyler Cutforth; clones selected by screening olfactory receptor cDNA libraries at low stringency with probes prepared by degenerate PCR, using primers to conserved sequences of the olfactory receptor gene family (Genome Biology 4:R71, and provided by Janet Young, Fred Hutchinson Cancer Research Center) were used as the starting template. 8 ul of each clone was inoculated in 1 ml LB containing the appropriate antibiotic. A BP recombinational reaction contains 2 ul of 5 X BP3 buffer; 2 ul of BP clonase; 1 ul of pDONR223 (150 ng/uL); 2 ul of PCR product (2-200 ng/uL); 3 uL H2O. The 5 X BP3 buffer consists of 100 mM Tris-Cl (pH 7.5); 20 mM EDTA; 30 mM spermidine-HCL; 25 percent glycerol; 225 mM NaCl. LR reactions we performed as described previously with minor changes (Reboul et al. 2003, Rual et al. 2004). BP products were transformed into liquid cultures of E. coli, with antibiotic selection of spectinomycin at 50 ug/mL. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGC-ORF-TTGccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Dana Farber Cancer Institute, Center for Cancer Systems Biology for the ORFeome Collaboration .

Cloned unidirectionally from mRNA prepared from oocytes isolated 46 hours after PMSG injection. NotI(dT) primer: 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'. SalI linker: 5'-TCGACCCACGCGTCCG-3'. cDNAs were size-selected for 500 bp and cloned into the SalI/NotI sites of pSPORT vector (Life Technologies). Average insert size: 1.5 kb. For aliquots of this library, please contact Dr. John Eppig, The Jackson Laboratory, 600 Main St., Bar Harbor ME 04609.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.5 kb resulted in an average insert size of 1.2 kb. This is a primarylibrary (normalized primary library is NIH_MGC_257) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.5 kb resulted in an average insert size of 1.0kb. This is a normalized library (primary library is NIH_MGC_256) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.2 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCAACAGTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCCTCTATTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 0.91 kb. Amplified once on solid support. cDNA Library Preparation: G. Chen in the laboratory of D. Melton, Ph.D. (Harvard University)

The cDNAs were prepared with an oligo containing a NotI site, and SalI linkers were added to the ends. The inserts were cut with NotI before being cloned into the NotI-SalI sites in the vector. Tissue was obtained from Gerard Gradwohl (PNAS 97:1607-1611, 2000). Library was prepared by Catherine S. Lee.

The cDNAs were prepared with an oligo containing a NotI site, and SalI linkers were added to the ends. The inserts were cut with NotI before being cloned into the NotI-SalI sites in the vector. Tissue was obtained from Gerard Gradwohl (PNAS 97:1607-1611, 2000). Library was prepared by Catherine S. Lee.

Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.47 kb. Amplified once on solid support. cDNA Library Preparation: G. Chen in the laboratory of D. Melton, Ph.D. (Harvard University).

Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.47 kb. Amplified once on solid support. cDNA Library Preparation: G. Chen in the laboratory of D. Melton, Ph.D. (Harvard University).

Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 0.91 kb. Primary library, unamplified. cDNA Library Preparation: G. Chen in the laboratory of D. Melton, Ph.D. (Harvard University)

Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. XhoI site destroyed during cloning (excise insert using XbaI/NotI). Size-selected by column fractionation; average insert size 1.2kb. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.06kb. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. XhoI site destroyed during cloning (excise insert using XbaI/NotI). Size-selected by column fractionation. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. XhoI site destroyed during cloning (excise insert using XbaI/NotI). Size-selected by column fractionation. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.1kb. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. XhoI site destroyed during cloning (excise insert using XbaI/NotI). Size-selected by column fractionation. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Five libraries representing EI0.5/12.5 pancreatic bud, E16.5 pancreas, newborn pancreas, adult pancreas, and adult islets of Langerhans were separately constructed using SuperScript Plasmid Library kit (Life Technologies). cDNA was made by oligo-dT priming using primer 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3' and size-selected by column fractionation. Cloning was accomplished via 5' linkers: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. Libraries were amplified once on solid support and plasmid DNA from each library was prepared and mixed in equal amounts. The mixed library DNA was normalized by method #4 from Bonaldo, Lennon, and Soares (1996 Genome Research 6:791-806); 0.5 microgram single-stranded mixed library plasmid DNA was mixed with 5 micrograms PCR product representing mixed library inserts and hybridized to an Ecot of 6. Single-stranded (unhybridized) plasmids were isolated by hydroxyapatite chromatography and used to make this library. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

'Library consists of a pool of clones rearrayed from the following libraries: Melton normalized mixed mouse pancreas 1 N1-MMS1, Amplified Melton mouse islets 1 MIS1-A, and Kaestner ngn3 wt. Clones rearrayed in the laboratory of K. Kaestner (University of Pennsylvania). Note: this is a NIH_MGC Library. '

'Library consists of a pool of clones rearrayed from the following libraries: Melton mouse adult pancreas 1 MAZ1, Melton mouse adult pancreas 2 MAZ2, Melton mouse E16.5 pancreas M16Z1, Melton mouse islets MIZ1, and Melton mouse newborn pancreas MNZ1. Clones rearrayed in the laboratory of K. Kaestner (University of Pennsylvania). Note: this is a NIH_MGC Library. '

'Library consists of a pool of clones rearrayed from the following library: Melton mouse E16.5 pancreas library 2 M16B2. Clones rearrayed in the laboratory of K. Kaestner (University of Pennsylvania). Note: this is a NIH_MGC Library. '

'Library consists of a pool of clones rearrayed from the following library: Kaestner ngn3 -/-. Clones rearrayed in the laboratory of K. Kaestner (University of Pennsylvania). Note: this is a NIH_MGC Library. '

' 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5'' -ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 2.05 kb (range 1.0-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

Double-stranded cDNA was prepared from cell line AtT-20 usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Double-stranded cDNA was prepared from cell line AtT-20 usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. This cell line was engineered for inducible overexpression of RESP18 using the rTET system. Cells were induced such that RESP18 protein would traverse the ER to the Golgi and induce the RESP18-activated signaling pathway. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

' RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.3 kb. This primary, microquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_222) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library. '

' RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.75kb resulted in an average insert size of 1.1 kb. This primary, nanoquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_223) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library. '

' RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1 kb resulted in an average insert size of 1.5 kb. Library is not amplified. (Normalized version of this library is NIH_MGC_203.) Library constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC Library. '

RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.75 kb resulted in an average insert size of 1.35 kb. Library was not amplified. (Normalized version of this library is NIH_MGC_204.) Library constructed by Express Genomics (Frederick, MD).

1st strand cDNA was prepared from medial nasal process tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGAGAGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double- stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTATAGACGCCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library was also constructed, Soares NMPR0. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa).

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCTATAGACGCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. A non-normalized version of this library was also constructed, Soares MPR0. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.96 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Whole skin from 11 week old C57BL/6 female mice. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.63 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGTCGACAAC 3' and 5' GTTGTCGACG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

mRNA made from flow-sorted NK cells, cDNA made by oligo-dT priming. Directionally cloned. Average insert size 1.5 kb. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTGTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Bertrand Jordan. Library went through three rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA), Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 4.8 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.7 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA) and Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 4.8 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.7 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library. Total RNA was obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA) and Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2.4 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH (http://lgsun.grc.nia.nih.gov/cDNA). This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA), Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 1.1 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA) and Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 1.1 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library. Total RNA was obtained from Drs. Dennis Taub, Dan Longo (National Institute on Aging, USA) and Jonathan Keller (National Cancer Institute, USA). Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 0.9 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.1 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH (http://lgsun.grc.nia.nih.gov/cDNA). This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Dr. Akihiro Umezawa (Keio University School of Medicine, Japan). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 2.2 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Akihiro Umezawa (Keio University School of Medicine, Japan). Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2.2 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Angelo L. Vescovi (Institute for Stem Cell Research, Italy). Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 2 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 3.2 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Angelo L. Vescovi (Institute for Stem Cell Research, Italy). Double- stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 3.8 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.5 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

Mouse cDNA project by the Laboratory of Genetics, National Institute on Aging (NIA), Intramural Research Program, NIH (http://lgsun.grc.nia.nih.gov/cDNA). This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Total RNAs were obtained from Dr. Janet Rossant and Tilo Kunath (Samuel Lunenfeld Research Institute, Canada). Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3'] from 4 5g of total RNA, treated with T4 DNA polymerase, and purified by ethanol-precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform, and separated from free linkers by Centricon 100. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform and Centricon 100. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV-SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 2.6 kb. The library was constructed by Yulan Piao.

This is a long-transcript enriched cDNA library. Total RNA was obtained from Dr. Janet Possant and Tilo Kunath (Samuel Lunenfeld Research Institute, Canada). Double-stranded cDNAs were synthesized with an oligo-dT primer (5'- pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3')from 4 ug of total RNA, treated with T4 DNA polymerase, and purified by ethanol precipitation. The cDNAs were ligated to Lone-linker LL-Sal4 (5'-AAGAGGTAATCC-3'), purified by phenol/chloroform, and separated from free linker by Centricon 100. The cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with primer Sal4-S. The cDNAs were digested with SalI and Not1I enzymes and cloned into SalI/NotI sites of pSPORT1 plasmid vector. The average insert size is about 2.6 kb. The library was constructed by Yulan Piao and Minoru Ko (NIH, NIA). Reference: Genome Res (2001) 11:1553-1558 [PMID: 11544199].

First-strand cDNA was primed with the oligo-dT primer 5'-AATTCGAGCGGCCGCT(30)VN-3' and a switch primer 5'-TACGGCTGCGAGAAGACGACAGAAGGG-3'. DNA was amplified by 26 cycles of PCR and then size selected for >0.5 kb. An aliquot was used to reamplify for 7 more cycles. The BstXI adaptor 5'-TACGGCTGCGAGAAGACGACAGAAGGG-3' was ligated at both ends and non-directionally cloned into the BstXI site of the pcDNAIII vector. Original library contained 7.5 million clones. Library constructed by Mike Clarke (University of Michigan). Note: this is a NIH_MGC library.

Cells were isolated by flow cytometry and RNA isolated in Trizol reagent. cDNA was obtained by reverse transcription using oligo-dT primer 5'-GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV-3'and treated with ExoI. PCR was performed using a complementary 3' primer containing a BstXI site and a cap-switch 5' primer. The resulting cDNA was digested with BstXI and ligated to a BstXI adaptor 5'-AAAAAAAAAAAAAAAAGTCGACATCGATACGCGTGGTCTCGTAGCTGACTTTCCAGCACA-3' then digested with AscI. Size-selection was performed >0.5 kb to result in an average insert size of 0.7 kb. Library constructed and contributed by Mike Clarke and Andrew Hass (University of Michigan). Note: this is an MGC library.

' Constructed by Gina Zastrow using the Bradfield Laboratory RACE method University of Wisconsin). Note: this is a NIH_MGC library. '

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.77 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1). Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TAAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Clones were synthesized by GENEART AG (Regensburg, Germany). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.

DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1). Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TCAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Clones were synthesized by GENEART AG (Regensburg, Germany). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.

Note: this is a Mammalian Gene Collection.

Note: this is a Mammalian Gene Collection.

Note: this is a Mammalian Gene Collection.

Note: this is a Mammalian Gene Collection.

Cloned unidirectionally. Primer: Oligo dT. M30 CD4+ cells. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGTCGACTTC 3' and 5' GAAGTCGACG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [5' AATTCACTAGTTTT 3' and 5' AAAACTAGTG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences).

cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences).

cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences).

cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences).

cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences).

cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library contains 98.5% recombinants. References: J. Androl. 20:635-639 and Gene 25:263-269. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences). Original lambda-based library is available through ATCC, catalog #63423.

cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library contains 98% recombinants. References: J. Androl. 20:635-639 and Gene 25:263-269. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences). Original lambda-based library is available through ATCC, catalog #63422.

cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library contains 96.5% recombinants. References: J. Androl. 20:635-639 and Gene 25:263-269. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences). Original lambda-based library is available through ATCC, catalog #63416.

cDNA oligo dT-primed [5'-(GA)10-ACTAGTCTCGAGTTTTTTTTTTTTT-3'] and directionally cloned using 5' linkers 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3'. Size selection of 400bp material gives average insert size ranging from 1-2 kb. Library was mass excised (from lambda-UniZAP-XR) and resulting single-stranded phagemids were prepped and tranformed into DH10B. Library contains 96% recombinants. References: J. Androl. 20:635-639 and Gene 25:263-269. Library constructed and donated by J. McCarrey, Ph.D. (Southwest Foundation for Biomedical Research, Dept. of Genetics); excision done by E.M. Eddy, Ph.D. (National Institutes of Health, National Institute of Environmental Health Sciences). Original lambda-based library is available through ATCC, catalog #63417.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

' 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C or G and N = A, C, G or T). Average insert size 1.4 kb (range 0.6-3.5 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

' cDNA made by oligo-dT priming and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5 kb size fraction. Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library. '

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_382 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_381 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_384 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_383 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_386 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_385 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_388 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_387 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer;double-stranded cDNA was ligated using 5' linker ggccgctat and 3' linker aactggaagcttaatt. Library is size-selected 2.5 kb and average insert size is 3.5 kb. Clones were arrayed from primary plating; non-amplified. Library constructed by X. Ren and L. Stubbs (Lawrence Livermore National Laboratory and DOE Joint Genome Institute, 7000 East Ave, L-453, Livermore, CA 94550).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. RNA provided by Dr. Bertrand Jordan. Library went through two rounds of normalization, and was constructed by Bento Soares and M.Fatima Bonaldo.

RNA obtained from 5 normal wild-type mice. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.2 kb. This primary, nanoquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_230) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library

RNA obtained from 5 normal wild-type mice thyroid. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.2 kb. Normalized version of this library is NIH_MGC_189ibrary constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC Library.

' 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5'' -ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.71 kb (range 0.5-3.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a NotI - oligo(dT) primer 5'-AACTGGAAGAATTCGCGGCCGCGGTTGTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTATCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Library was constructed by Bento Soares and M. Fatima Bonaldo.