mRNA made from liposarcoma, cDNA made by oligo-dT priming. Non- directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Two pooled bulk adrenal adenomas. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.6 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Pheochromocytoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.3 kb. Note: this is a NCI_CGAP Library.

'Cloned unidirectionally; oligo-dT primed. Average insert size 1.229 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATTGCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Germinal center B-cells Library constructed by Dr. L. Staudt (NCI). 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.1 kb. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from germinal B-cells (flow-sortedfrom tonsils) provided by Dr. Louis Staudt of the NCI, and was then primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCTCATTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo. This library was previously referred to as Soares NbHTGBC. Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.55 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

'Cloned unidirectionally; oligo-dT primed. Average insert size 1.7 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-1.14, NIH Registry designation UC01. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence. Passage 35. This line is a subclone of the parental line; the parental line was subcloned to remove aneuploid cells). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.9 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_279) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.

RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-1.14, NIH Registry designation UC01. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence. Passage 35. This line is a subclone of the parental line; the parental line was subcloned to remove aneuploid cells). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.82 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_278) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.

RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-6, NIH Registry designation UC06. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence Passage 62. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.8 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_281) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.

RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-6, NIH Registry designation UC06. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence Passage 62. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 2.0 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_280) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies, catalog #11998-010. Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 700 bp. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a Not I - oligo(dT)primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGGGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized; constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTAAGCGTCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DF1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTAAGCGTCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_DF0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGCTCAAGGCTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_ED1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGCTCAAGGCTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_ED0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACACTTGCACTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_EI1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACACTTGCACTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_EI0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

mRNA made from Ewing's sarcoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGGTCACTCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FG1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGGTCACTCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_FG0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTCTACGAGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

mRNA made from metastatic prostate lesion of the bone, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Synovial sarcoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.4 kb. Note: this is a NCI_CGAP Library.

'Cloned unidirectionally; oligo-dT primed. Average insert size 1.533 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

mRNA made from human bone marrow stroma, cDNA made by oligo-dT priming. Directionally cloned. Size-selected for average insert size 0.5 kb. Library constructed by Dr. Libin Jia (NHGRI).

mRNA made from flow-sorted CD34+/CD38- hematopoietic stem cells, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from lymphoid tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from lymphoid tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

' Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.75 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.9-4.0 kb). 14/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

Cloned unidirectionally. Primer: Oligo dT. Life Technologies catalog #: 10980-019 Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 0.9 kb. Life Technologies catalog #: 10981-017 Note: this is a NCI_CGAP Library.

cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.3-1.6 kb. Normalized to Cot10. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at http://hg.wustl.edu/COGENE/.

cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-2.0 kb. Normalized to Cot10. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at http://hg.wustl.edu/COGENE/.

Stanley Neuropathology Consortium (www.stanleylab.org) brains S-58, S-65, S-67, S-78. Random + oligo-dT primed into EcoRI site of ZAP II Vector. Mass excised. Avg insert length 1.9kb. Non-directionally cloned. Custom library provided by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

directionally cloned

directionally cloned, average insert size 1.38 kb

mRNA made from oligodendroglioma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. CITATION: National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index CONT_NAME: Robert Strausberg, Ph.D. COMMENT: cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. cDNA Library Arrayed by: I.M.A.G.E. Consortium, LLNL DNA Sequencing by: Washington University Genome Sequencing Center Note: this is a NCI_CGAP Library.

mRNA made from brain tumor tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATATCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATAGGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.33 kb. Tumor types include: meningioma, oligodendroglioma, astrocytoma (grade II), medulloblastoma, astrocytoma (grade IV). Life Technologies catalog #: 11544-012 Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATCACTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from medulloblastoma tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTTTCGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. This library is normalized. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

This library represents the normalized version of NCI_CGAP_Brn35. Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.19 kb. Tumor types include: meningioma, oligodendroglioma, astrocytoma (grade II), medulloblastoma, astrocytoma (grade IV). Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies, catalog #12005-013. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.57 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.77 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.64 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.3 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.9 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.0 kb. Life Technologies catalog #: 10979-011 Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.7 kb. Library constructed by Life Technologies, catalog #12001-012. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Two pooled bulk Schwannoma tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.2 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally from microquantity amounts of mRNA from normal endometrial tissue (late proliferative phase, cycle day 13). Average insert size 1.9 kb. Library constructed by ResGen (Invitrogen Corporation).

Cloned unidirectionally from microquantity amounts of mRNA from normal endometrial tissue (mid-secretory phase, cycle day 23). Average insert size 1.6 kb. Library constructed by ResGen (Invitrogen Corporation).

'RNA source anonymous pool of 6 male brains, age range 23-27 yo. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.5 kb, insert size range 1-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 019. Note: this is a NIH_MGC Library. '

' RNA source normal medulla from anonymous male age 27. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.3 kb, insert size range 0.9-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 013. Note: this is a NIH_MGC Library. '

' RNA source anonymous pool of 3 fetal brains, female age 20 weeks, female age 24 weeks, and male age 26 weeks. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.7 kb, insert size range 0.7-3.5 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 017. Note: this is a NIH_MGC Library. '

' RNA source male hippocampus, age 27. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.4 kb, insert size range 0.9-4 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 012. Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5-1 kb size fraction (other fractions present in NIH_MGC_127 and NIH_MGC_128). Library created in the laboratory of T. Usdin, M.D., Ph.D. (NIMH, NIH). Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 1-2 kb size fraction (other fractions present in NIH_MGC_126 and NIH_MGC_128). Library created in the laboratory of T. Usdin, M.D., Ph.D. (NIMH, NIH). Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the >2 kb size fraction (other fractions present in NIH_MGC_126 and NIH_MGC_127). Library created in the laboratory of T. Usdin, M.D., Ph.D. (NIMH, NIH). Note: this is a NIH_MGC Library. '

Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' and 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3'. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.2-0.5 kb size fraction (other fractions present in NIH_MGC_142). Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library.

Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' and 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3'. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the >0.5 kb size fraction (other fractions present in NIH_MGC_141). Library created in the laboratory of M. Brownstein (NIMH, NIH).