mRNA made from liposarcoma, cDNA made by oligo-dT priming. Non- directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Two pooled bulk adrenal adenomas. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.6 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Pheochromocytoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.3 kb. Note: this is a NCI_CGAP Library.

'Cloned unidirectionally; oligo-dT primed. Average insert size 1.229 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATTGCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Germinal center B-cells Library constructed by Dr. L. Staudt (NCI). 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.1 kb. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from germinal B-cells (flow-sortedfrom tonsils) provided by Dr. Louis Staudt of the NCI, and was then primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCTCATTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo. This library was previously referred to as Soares NbHTGBC. Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.55 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

'Cloned unidirectionally; oligo-dT primed. Average insert size 1.7 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-1.14, NIH Registry designation UC01. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence. Passage 35. This line is a subclone of the parental line; the parental line was subcloned to remove aneuploid cells). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.9 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_279) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.

RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-1.14, NIH Registry designation UC01. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence. Passage 35. This line is a subclone of the parental line; the parental line was subcloned to remove aneuploid cells). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.82 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_278) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.

RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-6, NIH Registry designation UC06. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence Passage 62. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.8 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_281) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.

RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-6, NIH Registry designation UC06. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence Passage 62. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 2.0 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_280) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies, catalog #11998-010. Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 700 bp. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a Not I - oligo(dT)primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGGGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized; constructed in the laboratory of M. Bento Soares (University of Iowa).

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTAAGCGTCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DF1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTAAGCGTCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_DF0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGCTCAAGGCTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_ED1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGCTCAAGGCTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_ED0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACACTTGCACTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_EI1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACACTTGCACTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_EI0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

mRNA made from Ewing's sarcoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGGTCACTCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FG1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGGTCACTCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_FG0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTCTACGAGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

mRNA made from metastatic prostate lesion of the bone, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Synovial sarcoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.4 kb. Note: this is a NCI_CGAP Library.

'Cloned unidirectionally; oligo-dT primed. Average insert size 1.533 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

mRNA made from human bone marrow stroma, cDNA made by oligo-dT priming. Directionally cloned. Size-selected for average insert size 0.5 kb. Library constructed by Dr. Libin Jia (NHGRI).

mRNA made from flow-sorted CD34+/CD38- hematopoietic stem cells, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from lymphoid tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from lymphoid tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

' Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.75 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.9-4.0 kb). 14/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

Cloned unidirectionally. Primer: Oligo dT. Life Technologies catalog #: 10980-019 Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 0.9 kb. Life Technologies catalog #: 10981-017 Note: this is a NCI_CGAP Library.

cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.3-1.6 kb. Normalized to Cot10. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at http://hg.wustl.edu/COGENE/.

cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-2.0 kb. Normalized to Cot10. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at http://hg.wustl.edu/COGENE/.

Stanley Neuropathology Consortium (www.stanleylab.org) brains S-58, S-65, S-67, S-78. Random + oligo-dT primed into EcoRI site of ZAP II Vector. Mass excised. Avg insert length 1.9kb. Non-directionally cloned. Custom library provided by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

directionally cloned

directionally cloned, average insert size 1.38 kb

mRNA made from oligodendroglioma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. CITATION: National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index CONT_NAME: Robert Strausberg, Ph.D. COMMENT: cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. cDNA Library Arrayed by: I.M.A.G.E. Consortium, LLNL DNA Sequencing by: Washington University Genome Sequencing Center Note: this is a NCI_CGAP Library.

mRNA made from brain tumor tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATATCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATAGGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.33 kb. Tumor types include: meningioma, oligodendroglioma, astrocytoma (grade II), medulloblastoma, astrocytoma (grade IV). Life Technologies catalog #: 11544-012 Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATCACTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from medulloblastoma tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTTTCGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. This library is normalized. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

This library represents the normalized version of NCI_CGAP_Brn35. Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.19 kb. Tumor types include: meningioma, oligodendroglioma, astrocytoma (grade II), medulloblastoma, astrocytoma (grade IV). Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies, catalog #12005-013. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.57 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.77 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.64 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.3 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.9 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.0 kb. Life Technologies catalog #: 10979-011 Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.7 kb. Library constructed by Life Technologies, catalog #12001-012. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Two pooled bulk Schwannoma tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.2 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally from microquantity amounts of mRNA from normal endometrial tissue (late proliferative phase, cycle day 13). Average insert size 1.9 kb. Library constructed by ResGen (Invitrogen Corporation).

Cloned unidirectionally from microquantity amounts of mRNA from normal endometrial tissue (mid-secretory phase, cycle day 23). Average insert size 1.6 kb. Library constructed by ResGen (Invitrogen Corporation).

'RNA source anonymous pool of 6 male brains, age range 23-27 yo. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.5 kb, insert size range 1-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 019. Note: this is a NIH_MGC Library. '

' RNA source normal medulla from anonymous male age 27. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.3 kb, insert size range 0.9-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 013. Note: this is a NIH_MGC Library. '

' RNA source anonymous pool of 3 fetal brains, female age 20 weeks, female age 24 weeks, and male age 26 weeks. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.7 kb, insert size range 0.7-3.5 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 017. Note: this is a NIH_MGC Library. '

' RNA source male hippocampus, age 27. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.4 kb, insert size range 0.9-4 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 012. Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5-1 kb size fraction (other fractions present in NIH_MGC_127 and NIH_MGC_128). Library created in the laboratory of T. Usdin, M.D., Ph.D. (NIMH, NIH). Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 1-2 kb size fraction (other fractions present in NIH_MGC_126 and NIH_MGC_128). Library created in the laboratory of T. Usdin, M.D., Ph.D. (NIMH, NIH). Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the >2 kb size fraction (other fractions present in NIH_MGC_126 and NIH_MGC_127). Library created in the laboratory of T. Usdin, M.D., Ph.D. (NIMH, NIH). Note: this is a NIH_MGC Library. '

Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' and 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3'. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.2-0.5 kb size fraction (other fractions present in NIH_MGC_142). Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library.

Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' and 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3'. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the >0.5 kb size fraction (other fractions present in NIH_MGC_141). Library created in the laboratory of M. Brownstein (NIMH, NIH).

' Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.42 kb. Library was constructed by Invitrogen. Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

The library was constructed by reverse transcription of 1 ug mRNA using the oligo dT primer GCGGCCGCCC(T)20 and an RNaseH + MMLV reverse transcriptase. Second strand synthesis was carried out by standard methods. The cDNA was size selected by agarose gel for > 1.2 kb, digested with Not I and directionally cloned into the vector Express-1 at the SmaI/NotI sites. DNA from the primary library was used for in vitro transcription from the T7 promoter to produce biotinylated RNA transcripts. These biotinylated transcripts, along with blocking oligos to the poly-A, multiple cloning site and primer regions, were hybridized with single stranded circles produced by phagmeid production from the primary library to a Cot value of 10-20. Strepavidin/phenol extraction was utilized to remove DNA:RNA hybrids leaving un-hybridized single stranded circles which were repaired by primer extension and transformed back into E. coli resulting in the normalized library. Average insert size 2.0 kb. 3' linker/adaptor sequence GCGGCCGCCC(T)20. This libary was constructed by Agencourt Bioscience.

Library is oligo-dT primed and directionally cloned. 5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30N-1N-3'. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected for >0.5kb with an average insert size of 1.3kb Library created in the laboratory of Jonathan Kuo and Ted Usdin. Note: this is a NIH_MGC Library

Library is oligo-dT primed and directionally cloned.5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)3N-1N-3. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected for >0.5kb with an average insert size of 1.2kb Library created in the laboratory of Jonathan Kuo and Ted Usdin.

Library is oligo-dT primed and directionally cloned.5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)3N-1N-3. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected for >0.5kb with an average insert size of 1.2kb Library created in the laboratory of Jonathan Kuo and Ted Usdin.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_272 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_274 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_264 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_266 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_287 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_286 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_289 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_288 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_307 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_306 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_309 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_308 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_311 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_310 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_313 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_312 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.55 kb (range 0.9-4.0 kb). 12/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

' 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.35 kb (range 0.5-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

' Oligo-dT primed using primer 5''-TTTTTTTTTTTTTTTTVN-3'', size-selected for average insert size 2.5 kb and normalized to ROT 5. This is a primary library enriched for full-length clones and constructed using the Cap-trapper method (Carninci, in preparation). Library constructed by M. Brownstein (NIMH/NHGRI, National Institutes of Health). Note: this is a NIH_MGC Library. '

' Oligo-dT primed using primer 5''-TTTTTTTTTTTTTTTTVN-3'', size-selected for average insert size 2.3 kb and normalized to ROT 5. This is a primary library enriched for full-length clones and constructed using the Cap-trapper method (Carninci, in preparation). Library constructed by M. Brownstein (NIMH/NHGRI, National Institutes of Health). Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

Double-stranded cDNA was prepared from human astrocytoma usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. Tumor identification by consensus pathology. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Double-stranded cDNA was prepared from human glioblastoma multiforme usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. Tumor identification by consensus pathology; shows LOH on chromosomes 10 and 14 and a gain in 9p and 1q. The tumor also has a heterozygous p53 mutation R273C. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Double-stranded cDNA was prepared from human meningioma usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. Tumor identification by consensus pathology. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Double-stranded cDNA was prepared from human oligodendroglioma usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. Tumor identification by consensus pathology; contains chromosome 1p and 19q deletion as determined by CGH. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Double-stranded cDNA was prepared from human fetal brain tissue. 5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-GAGAGAGAGAAGAGCTCAAGGATCCTTAATTAAATTAATCCCCCCCCCCCCC-3' and 3' adaptor sequence: 5'-GAGAGAGAGACTCGAGTTTTTTTTTTTTTTTTTT-3'. The library was size-selected for >0.5 kb inserts and has an average insert size estimated at 1.2 kb. This library was constructed using the CAP-trapper method for full-length enrichment and has not undergone amplification. Library was constructed by Dr. Claudio Schneider (LNCIB-Area Science Park, Trieste, Italy).

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' AACTGGAAGAATTCGCGGCCGCAGGAATTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Hind III adaptors (Pharmacia), digested with Not I and directionally cloned into the Not I and Hind III sites of the Lafmid BA vector. Library went through one round of normalization. Reference: PNAS 91, 9228-9232 (1994) Library constructed by Bento Soares and M. Fatima Bonaldo.

1st strand cDNA (prepared from RNA from 4 multiple sclerosis lesions from one patient, provided by Dr. K.G. Becker, NINDS/NIH) was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot5. Library constructed by Bento Soares and M. Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot50, and contains inserts larger than 1.5 kb. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot50, and contains inserts ranging from 0.5 to 1.5 kb. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' AACTGGAAGAATTCGCGGCCGCAATATTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two male bipolars, ages 34 and 48 (S-75, S-83) subtracted by pool of two mentally normal individuals, male, age 48 and female, age 35 (S-65, S-136). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two bipolar males, ages 45 and 50 (S-111, S-128) subtracted by pool of two mentally normal males, ages 41 and 53 (S-124, S-141). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two mentally normal males, ages 41 and 53 (S-124, S-141) subtracted by pool of two bipolar males, ages 45 and 50 (S-111, S-128). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two mentally normal male individuals ages 41 and 53 (S-124, S-141) subtracted by pool of two schizophrenic individuals, male age 44 and female age 56 (S-116, S-118). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two male schizophrenics, ages 30 and 32 (S-30, S-121) subtracted by pool of two male bipolars, age 34 and 48 (S-75, S-83). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. 34 yo schizophrenic male (S-11) subtracted by 28 yo mentally normal male (S-37). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two male schizophrenics, ages 30 and 32 (S-30, S-121) subtracted by pool of two mentally normal individuals, male, age 48 and female, age 35 (S-65, S-136). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two schizophrenics, male age 44 and female age 56 (S-116, S-118) subtracted by pool of two mentally normal male individuals ages 41 and 53 (S-124, S-141). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three bipolar individuals, male, ages 48 and 50, female, age 37 (S-47, S-83, S-128) subtracted by pool of three mentally normal individuals, male, ages 34 and 48, female, age 50 (S-65, S-67, S-164). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three bipolar individuals, male, ages 48 and 50, female, age 37 (S-47, S-83, S-128) subtracted by pool of three schizophrenic males, ages 34, 58 and 60 (S-11, S-64, S-109). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three mentally normal individuals, male, ages 34 and 48, female, age 50 (S-65, S-67, S-164) subtracted by pool of three bipolar individuals, male, ages 48 and 50, female, age 37 (S-47, S-83, S-128). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three mentally normal individuals, male, ages 34 and 48, female, age 50 (S-65, S-67, S-164) subtracted by pool of three schizophrenic males, ages 34, 58 and 60 (S-11, S-64, S-109). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three schizophrenic males, ages 34, 58 and 60 (S-11, S-64, S-109) subtracted by pool of three bipolar individuals, male, ages 48 and 50, female, age 37 (S-47, S-83, S-128). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three schizophrenic males, ages 34, 58 and 60 (S-11, S-64, S-109) subtracted by pool of three mentally normal individuals, male, ages 34 and 48, female, age 50 (S-65, S-67, S-164). Tissues were obtained from the Stanley Neuropathology Consortium (www.stanleylab.org). Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

Cloned unidirectionally. Primer: Oligo dT. Uninduced, exponentially growing neuroepithelial cells (Ntera-2/c1.D1). Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. NT2 cells (Ntera-2/c1.D1) induced with Retinoic Acid for 24 hours. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. NT2 (Ntera-2/c1.D1) precursor cells induced with Retinoic Acid for 1 week, followed by 3 weeks in mitotic inhibitors (Replate #2). Average insert size: 1.1 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. Differentiated, post mitotic hNT neurons. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Random + oligo-dT primed into EcoRI site of ZAP II Vector. Mass excised. Avg insert length 1.4kb. Non-directionally cloned. Custom library provided by Dr. Nancy Johnston [(410) 614-3918, nlj@welchlink.welch.jhu.edu].

1st strand cDNA was prepared from pooled bulk breast tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAACCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is not normalized. (The normalized version of this library is NCI_CGAP_Br2.) Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

mRNA made from breast carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Non-amplified library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from breast carcinoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from breast epithelium, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. CITATION: National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index CONT_NAME: Robert Strausberg, Ph.D. COMMENT: cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. cDNA Library Arrayed by: I.M.A.G.E. Consortium, LLNL Note: this is a NCI_CGAP Library.

mRNA made from breast adenocarcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 400 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from breast carcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 400 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from breast adenocarcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 400 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Library constructed by Life Technologies, catalog #12006-011. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from pooled bulk breast tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAACCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. This library is the normalized version of NCI_CGAP_Br1.1. Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.5 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Ductal breast tumor. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 0.9 kb.

mRNA made from normal breast ductal tissue, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from infiltrating ductal carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. Life Technologies catalog #:10985-018 Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

Cells were isolated by flow cytometry and RNA isolated in Trizol reagent. cDNA was obtained by reverse transcription using oligo-dT primer 5'-GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV-3'and treated with ExoI. PCR was performed using a complementary 3' primer containing a BstXI site and a cap-switch 5' primer. The resulting cDNA was digested with BstXI and ligated to a BstXI adaptor 5'-AAAAAAAAAAAAAAAAGTCGACATCGATACGCGTGGTCTCGTAGCTGACTTTCCAGCACA-3' then digested with AscI. Size-selection was performed >0.5 kb to result in an average insert size of 0.8 kb. Library constructed and contributed by Mike Clarke and Andrew Hass (University of Michigan). Note: this is an MGC library.

'Cloned unidirectionally; oligo-dT primed. Average insert size 1.383 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization to Cot230. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization to Cot20. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCTGATCACGCTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTGATCACGCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_EU1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTGATCACGCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_EU0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCATCTAATATGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_EZ1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCATCTAATATGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_EZ0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGCTACGGACTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FE1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGCTACGGACTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_FE0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAGAATCCGGCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FH1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAGAATCCGGCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_FH0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGAGGTCGGTGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FL1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGAGGTCGGTGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_FL0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

'Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.5 kb. Library prepared by Life Technologies. Note: this is a NIH_MGC Library. '

'Double-stranded cDNA was prepared from cell line RNA.
5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence:
5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence:
5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.7-3.7 kb).
This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA).
Note: this is a NIH_MGC Library.
'

'cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 1.8kb. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 900 bp. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'This library is a size selection of NIH_MGC_35, from 3.0-4.5 kb. Size selection done at the National Institute of Mental Health, NIH. Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGGGCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized; constructed by Bento Soares and M.Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGAAGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized; constructed by Bento Soares and M.Fatima Bonaldo.

Cloned unidirectionally. Primer: Oligo dT. HeLa S3 epithelioid carcinoma cells grown to semi-confluency without induction. Average insert size: 1.5 kb; Uni-ZAP XR Vector. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. Fetal cochlea, normal. 37% of inserts <0.5kb, 56% 0.5-1.0kb, 7% >1kb. Uni-ZAP XR Vector. Library constructed by N. Robertson, C. Morton. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Reference: Genomics 23, 42-50 (1994)

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCACTAGTAAT 3' and 5' ATTACTAGTG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Cloned unidirectionally. Primer: Oligo dT. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from RER+ colon tumor, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAACGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Non-normalized version of this library is named NCI_CGAP_Co9. Library was constructed by Bento Soares and M. Fatima Bonaldo (N-Soares4). Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Multiple colon tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.1 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Pooled colon tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.2 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.7 kb. Life Technologies catalog #: 11531-019 Note: this is a NCI_CGAP Library.

Plasmid DNA from the normalized library NCI_CGAP_Co10 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 1057416-1061255, and 1144584-1145351). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.9 kb. Library constructed by Life Technologies, catalog #11999-018. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.26 kb. Library constructed by Life Technologies. Normalized versions of this library named NCI_CGAP_Co19 (Cot 50), NCI_CGAP_Co20 (Cot 500), and NCI_CGAP_Co21 (Cot >500). Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Normalized to Cot50. Average insert size 1.32kb. Normalized version of NCI_CGAP_Co18. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Bulk colon villous adenoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.1 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Normalized to Cot 500. Average insert size 1.11kb. Normalized version of NCI_CGAP_Co18. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Normalized to Cot >500. Average insert size 1.04kb. Normalized version of NCI_CGAP_Co18. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from colonic metastasis, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from colonic adenocarcinoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from normal colonic mucosa, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from colonic adenocarcinoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from colonic mucosa, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from colonic adenoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from 12 pooled bulk tumor samples andprimed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCTTCGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from pooled colon tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCTTCGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. This library is not normalized. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from colon adenomcarcinoma, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGAATGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from RER+ colon tumor, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAACGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is not normalized. Normalized version of this library is named NCI_CGAP_Co10. Library was constructed by Bento Soares and M. Fatima Bonaldo (Soares4). Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_276 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_268 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_295 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_294 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_297 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_296 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

'Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGTCTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Tissue samples provided by Dr. Brian Dieckgraefe (Washington University, dieck@im.wustl.edu); colonic mucosa represents a range of disease involvement from moderate to severe Crohn's disease; samples include both perforating (fistulas) and non-perforating samples. Library constructed by Bento Soares and M. Fatima Bonaldo.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCTAGCTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Tissue samples provided by Dr. Brian Dieckgraefe (Washington University, dieck@im.wustl.edu); colonic mucosa represents a range of disease involvement from mild cryptitis to severe ulceration, fibrosis, and degeneration. Library constructed by Bento Soares and M. Fatima Bonaldo.

Cloned unidirectionally. Primer: Oligo dT. From carcinoma cell line T84. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. From adenocarcinoma HT-29 (HTB 38), moderately differentiated grade II. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Library constructed by Life Technologies, catalog #12004-016. Note: this is a NCI_CGAP Library.

' This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Undifferentiated human ES cell line H1 was obtained from WiCell Research Institute, Inc., Madison, Wi, cultured according to their instructions, and prepared for RNA extraction by Drs. Drs. Irene Ginis and Mahendra S. Rao. Briefly, cells were cultured on mouse embryonic fibroblast (MEF) feeders in ES cell medium consisting of DMEM/F12 (Invitrogen/GIBCO 11330-032) supplemented with 20% Knockout Serum Replacement, 100 mM MEM nonessential amino acids, 0.55 mM beta-mercaptoethanol, 2 mM L-glutamine, antibiotics/antimycotics, and with 4 ng/ml human basic fibroblast growth factor (bFGF) (all from Invitrogen/GIBCO). MEF derived from E12.5 mouse embryo were purchased from StemCell Technologiea, Inc. Vancouver, Canada. MEF were expanded on 0.5% bovine gelatin-coated dishes in DMEM medium (cat#11965-092) supplemented with 10% FBS (heat inactivated, Hyclone cat#3007103), 2 mM glutamine and 100 mM MEM non-essential amino acids. Subconfluent MEF cultures were treated with 1 mg/ml Mitomycin C (Sigma) for 3 hours to arrest cell division, trypsinized and plated at 0.2x105/cm2 onto 5% bovine collagen-coated dishes overnight. Feeders were washed twice with PBS; and then incubated in ES cell medium for at least 1 hour before plating ES cells. MEF''s of passage 2-3 were used as feeders. ES cells plated on top of MEF feeders were cultured at 5% CO2/5% O2 humidified tissue culture incubator from Thermo Forma. They formed round colonies with defined edges and were positive for alkaline phosphatase and SSEA-4. When confluent (18-10 days after plating) ES cells were treated with 1 mg/ml collagenase, type IV (Invitrogen/GIBCO) for 5-10 min and gently scraped off with 5 ml pipette. Cells from 4X6cm dishes were spun at 500 rpm for 3 min and the pellet was used for RNA purification. RNA was purified with TRIzol Reagent from Invitrogen. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3''] from 3.45g of total RNA, treated with T4 DNA polymerase, and purified by ethanol- precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform extraction, and separated from free linkers by Centricon-100 column. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform extraction and Centricon-100 column. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV- SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.6kb. The library was constructed by Yulan Piao. Note: this is a NIH_MGC Library. '

' Constructed by Gina Zastrow using the Bradfield Laboratory RACE method (University of Wisconsin). Note: this is a NIH_MGC Library. '

Library is oligo-dT primed using primer 5'-AAGCAGTGGTATCAACGCAGAGTGGCCGAGGCGGCCT(30)-3' and directionally cloned using 5' adaptor sequence: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCrGrGrG-3' Average insert size 0.96 kb (range 0.4-2.5 kb). Library is normalized and enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Reference: Biotechniques 30:892-897 (2001). Note: this is a NIH_MGC Library.

Library is oligo-dT primed using primer 5'-AAGCAGTGGTATCAACGCAGAGTGGCCGAGGCGGCCT(30)-3' and directionally cloned using 5' adaptor sequence: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCrGrGrG-3' Average insert size 1.04 kb (range 0.5-2.5 kb). Library is normalized and enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Reference: Biotechniques 30:892-897 (2001). Note: this is a NIH_MGC Library.

Library is oligo-dT primed using primer 5'-AAGCAGTGGTATCAACGCAGAGTGGCCGAGGCGGCCT(30)-3' and directionally cloned using 5' adaptor sequence: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCrGrGrG-3' Average insert size 0.9 kb (range 0.4-2.5 kb). Library is normalized and enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Reference: Biotechniques 30:892-897 (2001). Note: this is a NIH_MGC Library.

Bradfield Lab RACE method. Size selection 500-2kb, average insert size 550bp

Bradfield Lab RACE method, Size selection 2kb-5kb, average insert size 550bp.

'cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.2 kb resulted in an average insert size of 1.6 kb. This primary library is normalized to Cot10 (non-normalized primary library is NIH_MGC_258) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.'

'cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.9 kb. This primary library is not normalized (normalized primary library is NIH_MGC_261) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.'

'cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.5 kb. This primary library is normalized to Cot10 (non-normalized primary library is NIH_MGC_260) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.'

'cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 2.1 kb. This primary library is not normalized (normalized primary library is NIH_MGC_263) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.'

'cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.6 kb. This primary library is normalized to Cot10 (non-normalized primary library is NIH_MGC_262) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.'

Cloned unidirectionally. Primer: Oligo dT. Umbilical vein endothelial cells, passaged once. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Life Technologies catalog #: 11502-010 Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.75 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCACTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot50, and has an average insert length of 2 kb. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCACTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot50, and has an average insert length of 1 kb. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

Cloned unidirectionally. Primer: Oligo dT. Corneal fibroblasts grown out of explants from 76 year old donor. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. Pooled retinal tissue. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

1st strand cDNA was prepared from mRNA obtained from pooled 8-9 week (total) fetus material with a Not I - oligo(dT) primer [5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTTAATTTTTTTTTTTTTTTTT-3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

1st strand was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAACCATTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

Cloned unidirectionally. Primer: Oligo dT. WI-38 lung fibroblast cell line grown to confluency. Average insert size: 0.8 kb; Uni-ZAP XR Vector. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Bulk germ cell tumor. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.2 kb. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from 3 pooled germ cell tumors, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAATCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is not normalized. Normalized version of this library is named NCI_CGAP_GC4. Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from 3 pooled germ cell tumors, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAATCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Non-normalized version of this library is named NCI_CGAP_GC3. Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Mixed germ cell tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 0.7 kb. Note: this is a NCI_CGAP Library.

Plasmid DNA from the normalized library NCI_CGAP_GC4 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 1257096-1258631, 1469064-1470983, and 1475592-1476743). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. 5' adaptor sequence: 5' AATTCGGCACGAG 3' 3' GCCGTGCTC 5' 3' adaptor sequence: 5' (GA)10ACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3' EcoRI site appears to have been lost in a fraction of the clones. Library constructed by Stratagene; available through Mary May, PhD (Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, NIH; mmay@yoda.nidr.nih.gov). Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. 5' adaptor sequence: 5' AATTCGGCACGAG 3' 3' GCCGTGCTC 5' 3' adaptor sequence: 5' (GA)10ACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3' EcoRI site appears to have been lost in a fraction of the clones. Library constructed by Stratagene; available through Mary May, PhD (Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, NIH; mmay@yoda.nidr.nih.gov). Note: this is a NCI_CGAP Library.

' Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.68. Library was constructed by Invitrogen. Note: this is a NIH_MGC Library. '

cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-1.2 kb. Normalized to Cot10. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at http://hg.wustl.edu/COGENE/.

cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-2.0 kb. Normalized to Cot5. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at http://hg.wustl.edu/COGENE/.

cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-1.8 kb. Normalized to Cot5. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at http://hg.wustl.edu/COGENE/.

cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-1.6 kb. Normalized to Cot5. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at http://hg.wustl.edu/COGENE/.

cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-2.5 kb. Normalized to Cot10. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at http://hg.wustl.edu/COGENE/.

mRNA made from head/neck tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from head/neck tumor, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGGATCCAAC 3' and 5' GTTGGATCCG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGGATCGAAC 3' and 5' GTTGGATCGG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

directionally cloned, average insert size 1.72 kb

' 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.25 kb (range 0.6-4.0 kb). 14/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

1st strand was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATCTTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

RNA was prepared from a pool of anonymous Wilms' tumors by acid-phenol extraction. cDNA was synthesized with the Life Technologies Superscript plasmid system using an oligo dT-NotI primer for first strand synthesis. A SalI adaptor was ligated to the 5' ends of the clones. cDNA was size- selected on columns, NotI digested, and ligated into NotI/SalI-cut pSPORT1 and electroporated into DH10B cells. Average insert size: 2.0 kb. Library was constructed by Dr. Manfred Gessler.

Cloned unidirectionally. Primer: Oligo dT. Caucasian. Average insert size: 1.32 kb; pCMV-SPORT vector.

mRNA made from invasive kidney tumor, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Plasmid DNA from the normalized library NCI_CGAP_Kid3 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 1322376-1323911, 1456007-1456775, and 1500552-1502855). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Plasmid DNA from the normalized library NCI_CGAP_Kid5 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 1323912-1325831, 1471368-1472903 and 1492104-1493255). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' AACTGGAAGAATTCGCGGCCGCAATGCTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to Eco RI adaptors (Pharmacia), digested with Not I and cloned into the Not I and Eco RI sites of the modified pT7T3 vector. mRNA source: 2 pooled kidneys. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' AACTGGAAGAATTCGCGGCCGCAATCTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Pooled kidney tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.0 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. 5 pooled kidney tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.3 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. Life Technologies catalog #: 11524-014 Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.35 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

' 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.5-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

'Cloned unidirectionally; oligo-dT primed. Average insert size 1.3 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' (GA)10ACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3' Library constructed by Stratagene. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Larynx squamous carcinoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 0.9 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size: 1.3 kb; pCMV-SPORT vector.

' RNA source leukocytes from anonymous pool of non-activated adult donors. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.7 kb, insert size range 1.2-3.3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 027. Note: this is a NIH_MGC Library. '

directionally cloned

directionally cloned, average insert size 1.6 kb

Cloned unidirectionally. Primer: Oligo dT. Life Technologies catalog #: 10989-010 Note: this is a NCI_CGAP Library.

mRNA made from normal liver hepatocytes, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from invasive hepatocellular carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size- selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 0.8 kb. Life Technologies catalog #: 10986-016 Note: this is a NCI_CGAP Library.

cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from metastatic prostate lesion of the liver, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_291 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_290 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_293 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_292 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

' 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.85 kb (range 1.0-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

'Cloned unidirectionally; oligo-dT primed. Average insert size 1.7 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

Cloned unidirectionally. Primer: Oligo dT. Hepatectomy from normal male caucasian. Average insert size: 1.1 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

directionally cloned

directionally cloned, average insert size 1.3 kb

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGATCATTGCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DH1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGATCATTGCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_DH0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATACGCGGTCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAACTGTTCGGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DT1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAACTGTTCGGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_DT0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

Cloned unidirectionally. Primer: Oligo dT. Bulk lung tumor. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.1 kb. Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGCCGGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from pooled lung tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGACAGCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Plasmid DNA from the normalized library NCI_CGAP_Lu5 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 1414920-1417991 and 1520904-1522439). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

mRNA made from lung carcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

mRNA made from lung adenocarcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies, catalog #12007-019. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Library constructed by Life Technologies, catalog #12008-017. Note: this is a NCI_CGAP Library.

Cloned unidirectionally, no 5' adaptor. Primer: Oligo dT. Full-length library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

1st strand cDNA was prepared from neuroendocrine lung carcinoid, and was then primed with a Not I - oligo(dT) primer [5'-AACTGGAAGAATTCGCGGCCGCCAACTTTTTTTTTTTTTTTTTTT-3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized and was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. Life Technologies catalog #: 10991-016 Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Life Technologies catalog #: 10992-014 Note: this is a NCI_CGAP Library.

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

Non-normalized full-length enriched library from pooled lung metastases (cell lines) . The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCGATAAGGCCATTTTTTTTTTTTTTTTTT -3') contains the sequence tag GATAAGGCCA between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library constructed by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa). Note: this is a NIH_MGC Library.

Non-normalized full-length enriched library from pooled lung metastases (cell lines) . The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCGATAAGGCCATTTTTTTTTTTTTTTTTT -3') contains the sequence tag GATAAGGCCA between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library constructed by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa). Note: this is a NIH_MGC Library.

Non-normalized full-length enriched library from pooled lung metastases (cell lines) . The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCGATAAGGCCATTTTTTTTTTTTTTTTTT -3') contains the sequence tag GATAAGGCCA between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library constructed by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa). Note: this is a NIH_MGC Library.

Non-normalized full-length enriched library from pooled lung metastases (cell lines) . The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCGATAAGGCCATTTTTTTTTTTTTTTTTT -3') contains the sequence tag GATAAGGCCA between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library constructed by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa). Note: this is a NIH_MGC Library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_273 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_265 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_299 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_298 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_301 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_300 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

' Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

'Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library. '

'Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

' 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.9 kb (range 0.5-4.0 kb). 12/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

1st strand was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAATTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

Cloned unidirectionally. Primer: Oligo dT. Normal lung. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Cloned unidirectionally. Primer: Oligo dT. Small cell carcinoma cell line NCI-H69. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

'cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 840 bp. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library. '

' Library was derived from 1.35-2.37 kb mRNA size fraction;1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library. '

' Library was derived from 0.5-1.35 kb mRNA size fraction;1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library. '

' Library was derived from 2.37-3.5 kb mRNA size fraction;1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library. '

' Library was derived from 3.5-4.4 kb mRNA size fraction;1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library. '

' Library was derived from 4.4-7.4 kb mRNA size fraction;1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library. '

' Library was derived from 7.4-9.5 kb mRNA size fraction; 1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library. '

' Double-stranded cDNA was prepared from lymphocyte cell line. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CATAGGATCCGTCGACCCCCCCC-3'' and 3'' adaptor sequence: 5''-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3''. This library was constructed using the CAP-trapper method for full-length enrichment and was constructed by Dr. Claudio Schneider (LNCIB-Area Science Park, Trieste, Italy). Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

'Cloned unidirectionally; oligo-dT primed. Average insert size 1.867 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library. '

'cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library. '

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' (GA)10ACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3' Library constructed by Stratagene. Note: this is a NCI_CGAP Library.

mRNA made from bone marrow, stem cells 34+/38+, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 400 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.25 kb. Life Technologies catalog #: 11547-015 Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. 10 pooled lymphomas. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 0.9 kb. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. Non-amplified library. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 0.8 kb. Non-amplified library. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGGCCATGCCGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version (NCI_CGAP_FT1) and a subtracted version (NCI_CGAP_FT2) of this library are also available. Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGGCCATGCCGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version, NCI_CGAP_FT0, as well as a subtracted version, NCI_CGAP_FT2, of this library are also available). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGGCCATGCCGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is subtracted (a non-normalized version, NCI_CGAP_FT0, and normalized version, NCI_CGAP_FT1, of this library are also available). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

Full open reading frame clones were created in the Gateway system by the M. Vidal laboratory (reference Genome Res. 2004 Oct;14(10B):2128-35) using MGC clones as templates. For PCR amplification, both forward and reverse ORF-specific primers for each MGC clone were designed automatically using the OSP program (Hillier and Green 1991). The forward primer starts from A of the ATG initiation codon, whereas the reverse primer starts from the second nucleotide of the termination codon. The reverse attB2.1 primers do not contain the last nucleotide of the termination codon, so as to allow generation of C-terminal fusion proteins. This library is specifically made of single colonies isolated at Lawrence Livermore National Laboratory from the transformed ORF pools. Clones were prepared by the M. Vidal laboratory (Dana Farber Cancer Institute) and generously donated for use by the NIH_MGC project.

cDNA made by oligo-dT priming. Directionally cloned into EcoRV (site destroyed upon cloning) and NotI. The library was size-selected and went through 26K fold of amplification. Average insert size is 1.8 kb. Library constructed from cell lines ZR-75-1, MCF7, SK-BR-3, MDA-MB-231, hTERT-HME1, LNCaP and subtracted against brain, liver, lung, kidney and muscle. cDNA Library constructed by Life Technologies (Invitrogen). The ZR-75-1, MCF7, SK-BR-3, MDA-MB-231, and LNCaP cell lines were acquired from ATCC. The hTERT-HME1 cell line was purchased from Clontech. REFERENCE: Kristi A. Egland, James J. Vincent, Robert Strausberg, Bungkook Lee, and Ira Pastan: Discovery of new breast cancer genes encoding membrane and secreted proteins. Manuscript submitted. (National Cancer Institute, National Institutes of Health).

This subtracted library was derived from a pool of thefollowing 21 normalized and/or subtracted libraries: NCI_CGAP_Co4, Pr22, Pr28, Co10, Co16, Kid5, Kid12, Kid3, Kid11, Lym2, Br2, Co8, CLL1, Lei2, Brn23, Lu5, Lu24, Lu19, GC4, GC6, and Brn25. Library was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

This subtracted library was derived from a pool of thefollowing four normalized libraries: NCI_CGAP_Ov18, Lu13, GCB1, and Brn50. Library was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

This subtracted library was derived from NCI_CGAP_Sub6.Library was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

This subtracted library was derived from a mixture of the followingnormalized and/or subtracted libraries: NCI_CGAP_Co4, Pr22, Pr28, Co10, Co16, Kid5, Kid12, Kid3, Kid11, Lym2, Br2, Co8, CLL1, Lei2, Brn23, Lu5, Lu24, Lu19, GC4, GC6, and Brn25. Library was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.

This subtracted library was derived from a pool of libraries and tissues: colonic mucosa from Crohn's disease (Soares/Dieckgraefe NHUC, normalized, tag TAGC), colonic mucosa from ulcerative colitis (Soares/Dieckgraefe NHCD, normalized, tag CGTC), fetal thymus (Soares NHFTh, normalized, tag AACG), cervix (Soares NHCe, normalized, tag GGGCC), cervical adenosquamous carcinoma (Soares NHCec, normalized, tag CGAAG), ligament cells, prostate carcinoma, bladder carcinoma, and brain oligodendroglioma (NCI_CGAP_Brn41, normalized, tag ATCAC). Library constructed by M. Bento Soares and Maria de Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

' RNA source anonymous pool of 6 male brains, age range 23-27; 1 male lung, age 27; and 1 male testis, age 69. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.8 kb, insert size range 1-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 021. Note: this is a NIH_MGC Library. '

' RNA source anonymous pool of 3 colons, age 26 yo male, 49 yo female, 71 yo male colon; 46 yo male kidney, and pool of 2 stomachs, 62 yo male and 70 yo female. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.4 kb, insert size range 1-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 023. Note: this is a NIH_MGC Library. '

RNA source anonymous pool of 24 week male brain, 21 week female liver, and six male and female hearts ranging from 20-24 weeks. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 2.1 kb, insert size range 1-3.5 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 024. Note: this is a NIH_MGC Library.

' RNA source anonymous pool of spleen and pancreas from 28 yo male. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.5 kb, insert size range 1-2.5 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 025. Note: this is a NIH_MGC Library. '

' RNA source anonymous pool of 24 week female lung, 16 week female spleen, and 20-22 week male spleens. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.4 kb, insert size range 1-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 026. Note: this is a NIH_MGC Library. '

'ORFs were PCR-amplified and cloned into pcDNA3 and related vectors by the GPCR Consortium. For information about which gene each clone represents as well as the vectors and cloning sites (which vary by clone), please visit our anonymous ftp site at ftp://image.hudsonalpha.org/image/rearrayed_plates/IRBF-IRBI.preSV.data Note: this is a NIH_MGC Library. '

ORFs were PCR-amplified (from IMAGE clones or from commercially available cDNA libraries) and cloned by the Guthrie cDNA Resource Center (www.guthrie.org/cDNA) into pcDNA3.1. For specific information on cloning sites (which vary by clone), please refer to the Guthrie website, using the Guthrie ID given in the file ftp://image.hudsonalpha.org/image/rearrayed_plates/IRBF.preSV.data

' Library is oligo-dT primed and directionally cloned. cDNA was prepared from a glandular pool of tissues from thyoid, parathyroid, adrenal, cortex and pineal gland. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.38 kb (range 0.60-3.5 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

' Library is oligo-dT primed and directionally cloned. cDNA was prepared from a pooled samples of tissues from Skin, meninges, duramatter, pia matter and choroid plexus. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.47 kb (range 0.50-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

' Library is oligo-dT primed and directionally cloned. cDNA was prepared from a pooled samples of tissues from Blood vessels, aorta, basilar and artery. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.10 kb (range 0.50-3.5 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library. '

Clones from this library have been PCR-amplified using gene-specific primers to contain the complete open reading frame (based on known gene sequences available from NCBI's RefSeq). Template for PCR is cDNA derived from either pooled cytoplasmic polyA RNA from 30 cells lines or pooled total RNA from 10 different tissues (from BD Biosciences/Clontech and Washington University). PCR products are directionally cloned into the loxP sites of the pDNR-Dual vector. Library constructed by Dr. Narayan Bhat, Earl Bere III and Hongling Liao (Gene Expression Laboratory, Research Technology Program, SAIC Frederick, NCI-Frederick, Frederick, MD 21702). For information on which gene each clone represents, please visit our anonymous ftp site at ftp://image.hudsonalpha.org/image/rearrayed_plates/IRBK-IRCC.preSV.data. Note: this is a NIH_MGC Library. '

Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 0.5-1Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Average insert size 0.5-1kb. Library was constructed in the laboratory of M. Bento Soares. Note: this is a NIH_MGC Library.

Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 0.5-1Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of

Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 2-3Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter priner 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of M. Bento Soares. Note: this is a NIH_MGC Library

Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 0.5-1Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of M. Bento Soares. Average insert size 3-4kb Note: this is a NIH_MGC Library.||

Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 4-5Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of M. Bento Soares. Note: this is a NIH_MGC Library

'This library consists of a subset of clones from various MGC libraries that were found to have errors in their sequence, possibly the result of artifacts in cDNA library construction. These errors were repaired using site-directed mutagenesis by Modular Genetics Inc. (Woburn, MA). Note: this is a NIH_MGC Library. '

Library was constructed from RT-PCR products generated from the BD Biosciences Clontech Human Total RNA Master Panel II (consisting of RNAs from 20 different tissues). Product from the RT-PCR was purified using QIAGEN PCR columns and ends were repaired for blunt-end ligation into the SrfI site of pPCR-Script Amp SK(+). Clones are oriented with 5' end nearest EcoRI site and 3' end nearest NotI site. Companion library NIH_MGC_277 has clones in the opposite orientation. Reference: Wu et al. (2004, Biotechniques in press). Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_271 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_245 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Library was constructed from RT-PCR products generated from the BD Biosciences Clontech Human Total RNA Master Panel II (consisting of RNAs from 20 different tissues). Product from the RT-PCR was purified using QIAGEN PCR columns and ends were repaired for blunt-end ligation into the SrfI site of pPCR-Script Amp SK(+). Clones are oriented with 5' end nearest the NotI site and 3' end nearest the EcoRI site. Companion library NIH_MGC_244 has clones in the opposite orientation. Reference: Wu et al. (2004, Biotechniques in press). Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a Mammalian Gene Collection library.

Library was constructed from RT-PCR products generated from the BD Biosciences Clontech Human Total RNA Master Panel II (consisting of RNAs from 20 different tissues). Inserts are cloned into the TOPO site and oriented with 5' end nearest the SpeI site and 3' end nearest the PstI site. Inserts can be excised using EcoRI. Companion library NIH_MGC_283 has clones in the opposite orientation. Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a NIH_MGC Library.

Library was constructed from RT-PCR products generated from the BD Biosciences Clontech Human Total RNA Master Panel II (consisting of RNAs from 20 different tissues). Inserts are cloned into the TOPO site and oriented with 5' end nearest the PstI site and 3' end nearest the SpeI site. Inserts can be excised using EcoRI. Companion library NIH_MGC_282 has clones in the opposite orientation. Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a NIH_MGC Library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_315 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_314 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_317 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_316 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_319 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_318 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_321 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_320 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_323 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_322 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_325 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_324 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_327 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_326 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_329 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_328 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones from this library have been PCR-amplified using gene-specific primers to contain the complete open reading frame (based on known gene sequences available from NCBI's RefSeq). Template for PCR is cDNA derived from either pooled cytoplasmic polyA RNA from 30 cells lines or pooled total RNA from 10 different tissues (from BD Biosciences/Clontech and Washington University). PCR products are non-directionally cloned into the TOPO sites of the pCR-BluntII-TOPO vector. Library constructed by Dr. Narayan Bhat, Earl Bere III and Hongling Liao (Gene Expression Laboratory, Research Technology Program, SAIC Frederick, NCI-Frederick, Frederick, MD 21702). For information on which gene each clone represents, and the orientation in which it's cloned (determined by sequence analysis; this library represents the forward direction and NIH_MGC_332 represents the reverse direction) please visit our anonymous ftp site at ftp://image.hudsonalpha.org/image/rearrayed_plates/IRBK-IRCC.preSV.data Note: this is a NIH_MGC Library.

Clones from this library have been PCR-amplified using gene-specific primers to contain the complete open reading frame (based on known gene sequences available from NCBI's RefSeq). Template for PCR is cDNA derived from either pooled cytoplasmic polyA RNA from 30 cells lines or pooled total RNA from 10 different tissues (from BD Biosciences/Clontech and Washington University). PCR products are non-directionally cloned into the TOPO sites of the pCR-BluntII-TOPO vector. Library constructed by Dr. Narayan Bhat, Earl Bere III and Hongling Liao (Gene Expression Laboratory, Research Technology Program, SAIC Frederick, NCI-Frederick, Frederick, MD 21702). For information on which gene each clone represents, and the orientation in which it's cloned (determined by sequence analysis; this library represents the reverse direction and NIH_MGC_330 represents the forward direction) please visit our anonymous ftp site at ftp://image.hudsonalpha.org/image/rearrayed_plates/IRBK-IRCC.preSV.data Note: this is a NIH_MGC Library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_334 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_333 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_336 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_335 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_338 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_337 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_340 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_339 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.